ID: 1001702844

View in Genome Browser
Species Human (GRCh38)
Location 5:173720213-173720235
Sequence GCTTTGAATAAAGCTAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001702844_1001702846 1 Left 1001702844 5:173720213-173720235 CCTATTTTAGCTTTATTCAAAGC No data
Right 1001702846 5:173720237-173720259 ATTTTATCTTGTGTGATCAAGGG No data
1001702844_1001702845 0 Left 1001702844 5:173720213-173720235 CCTATTTTAGCTTTATTCAAAGC No data
Right 1001702845 5:173720236-173720258 AATTTTATCTTGTGTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001702844 Original CRISPR GCTTTGAATAAAGCTAAAAT AGG (reversed) Intergenic
No off target data available for this crispr