ID: 1001702846

View in Genome Browser
Species Human (GRCh38)
Location 5:173720237-173720259
Sequence ATTTTATCTTGTGTGATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001702844_1001702846 1 Left 1001702844 5:173720213-173720235 CCTATTTTAGCTTTATTCAAAGC No data
Right 1001702846 5:173720237-173720259 ATTTTATCTTGTGTGATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001702846 Original CRISPR ATTTTATCTTGTGTGATCAA GGG Intergenic
No off target data available for this crispr