ID: 1001704000

View in Genome Browser
Species Human (GRCh38)
Location 5:173728831-173728853
Sequence GAGAGACCCCGCACGCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001704000_1001704008 16 Left 1001704000 5:173728831-173728853 CCAATCAGCGTGCGGGGTCTCTC No data
Right 1001704008 5:173728870-173728892 TAGTGTATCCTGGCTCTGTCCGG No data
1001704000_1001704002 -10 Left 1001704000 5:173728831-173728853 CCAATCAGCGTGCGGGGTCTCTC No data
Right 1001704002 5:173728844-173728866 GGGGTCTCTCCACAGGCCCATGG No data
1001704000_1001704006 6 Left 1001704000 5:173728831-173728853 CCAATCAGCGTGCGGGGTCTCTC No data
Right 1001704006 5:173728860-173728882 CCCATGGGCTTAGTGTATCCTGG No data
1001704000_1001704003 -9 Left 1001704000 5:173728831-173728853 CCAATCAGCGTGCGGGGTCTCTC No data
Right 1001704003 5:173728845-173728867 GGGTCTCTCCACAGGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001704000 Original CRISPR GAGAGACCCCGCACGCTGAT TGG (reversed) Intergenic
No off target data available for this crispr