ID: 1001704462

View in Genome Browser
Species Human (GRCh38)
Location 5:173731732-173731754
Sequence CCAAGCCAGGACTGTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001704462_1001704466 -4 Left 1001704462 5:173731732-173731754 CCCATGGCACAGTCCTGGCTTGG No data
Right 1001704466 5:173731751-173731773 TTGGATTCTCAGCTCTGAAGTGG No data
1001704462_1001704467 16 Left 1001704462 5:173731732-173731754 CCCATGGCACAGTCCTGGCTTGG No data
Right 1001704467 5:173731771-173731793 TGGACAAGCTCTCCAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001704462 Original CRISPR CCAAGCCAGGACTGTGCCAT GGG (reversed) Intergenic
No off target data available for this crispr