ID: 1001705423

View in Genome Browser
Species Human (GRCh38)
Location 5:173737903-173737925
Sequence GGTACCAGGCCAATAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001705414_1001705423 18 Left 1001705414 5:173737862-173737884 CCAAACTCTCTGAACCTAAGTGG No data
Right 1001705423 5:173737903-173737925 GGTACCAGGCCAATAGGCTATGG No data
1001705418_1001705423 4 Left 1001705418 5:173737876-173737898 CCTAAGTGGGAACAGGCCTCTGT No data
Right 1001705423 5:173737903-173737925 GGTACCAGGCCAATAGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001705423 Original CRISPR GGTACCAGGCCAATAGGCTA TGG Intergenic
No off target data available for this crispr