ID: 1001706193

View in Genome Browser
Species Human (GRCh38)
Location 5:173742843-173742865
Sequence GTTCTACGTTGTCATCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001706193_1001706198 20 Left 1001706193 5:173742843-173742865 CCTTCTTGATGACAACGTAGAAC No data
Right 1001706198 5:173742886-173742908 CCAGGATAGTCCCCTACTGATGG No data
1001706193_1001706195 2 Left 1001706193 5:173742843-173742865 CCTTCTTGATGACAACGTAGAAC No data
Right 1001706195 5:173742868-173742890 CACTCTATGATTGTACCACCAGG No data
1001706193_1001706199 29 Left 1001706193 5:173742843-173742865 CCTTCTTGATGACAACGTAGAAC No data
Right 1001706199 5:173742895-173742917 TCCCCTACTGATGGACAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001706193 Original CRISPR GTTCTACGTTGTCATCAAGA AGG (reversed) Intergenic