ID: 1001706195

View in Genome Browser
Species Human (GRCh38)
Location 5:173742868-173742890
Sequence CACTCTATGATTGTACCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001706193_1001706195 2 Left 1001706193 5:173742843-173742865 CCTTCTTGATGACAACGTAGAAC No data
Right 1001706195 5:173742868-173742890 CACTCTATGATTGTACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001706195 Original CRISPR CACTCTATGATTGTACCACC AGG Intergenic