ID: 1001706199 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:173742895-173742917 |
Sequence | TCCCCTACTGATGGACAGTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1001706194_1001706199 | 5 | Left | 1001706194 | 5:173742867-173742889 | CCACTCTATGATTGTACCACCAG | No data | ||
Right | 1001706199 | 5:173742895-173742917 | TCCCCTACTGATGGACAGTTAGG | No data | ||||
1001706193_1001706199 | 29 | Left | 1001706193 | 5:173742843-173742865 | CCTTCTTGATGACAACGTAGAAC | No data | ||
Right | 1001706199 | 5:173742895-173742917 | TCCCCTACTGATGGACAGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1001706199 | Original CRISPR | TCCCCTACTGATGGACAGTT AGG | Intergenic | ||