ID: 1001706199

View in Genome Browser
Species Human (GRCh38)
Location 5:173742895-173742917
Sequence TCCCCTACTGATGGACAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001706194_1001706199 5 Left 1001706194 5:173742867-173742889 CCACTCTATGATTGTACCACCAG No data
Right 1001706199 5:173742895-173742917 TCCCCTACTGATGGACAGTTAGG No data
1001706193_1001706199 29 Left 1001706193 5:173742843-173742865 CCTTCTTGATGACAACGTAGAAC No data
Right 1001706199 5:173742895-173742917 TCCCCTACTGATGGACAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001706199 Original CRISPR TCCCCTACTGATGGACAGTT AGG Intergenic