ID: 1001708310

View in Genome Browser
Species Human (GRCh38)
Location 5:173758112-173758134
Sequence CAGGTGGAAGATCTGGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001708301_1001708310 10 Left 1001708301 5:173758079-173758101 CCTTGCAGTGGAGAAGACTTCTG No data
Right 1001708310 5:173758112-173758134 CAGGTGGAAGATCTGGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001708310 Original CRISPR CAGGTGGAAGATCTGGGGGT AGG Intergenic
No off target data available for this crispr