ID: 1001709732

View in Genome Browser
Species Human (GRCh38)
Location 5:173768579-173768601
Sequence ACTTGCTAGCCATATGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001709729_1001709732 -10 Left 1001709729 5:173768566-173768588 CCTCAGTTCTGCCACTTGCTAGC No data
Right 1001709732 5:173768579-173768601 ACTTGCTAGCCATATGATGTGGG No data
1001709728_1001709732 3 Left 1001709728 5:173768553-173768575 CCTGAGTTGCAAGCCTCAGTTCT No data
Right 1001709732 5:173768579-173768601 ACTTGCTAGCCATATGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001709732 Original CRISPR ACTTGCTAGCCATATGATGT GGG Intergenic
No off target data available for this crispr