ID: 1001710086

View in Genome Browser
Species Human (GRCh38)
Location 5:173771579-173771601
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001710083_1001710086 27 Left 1001710083 5:173771529-173771551 CCGTTTAGGATTAAAGTCTAAAC No data
Right 1001710086 5:173771579-173771601 CAGCATTTCCCGGTGCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001710086 Original CRISPR CAGCATTTCCCGGTGCTCCA CGG Intergenic
No off target data available for this crispr