ID: 1001711889

View in Genome Browser
Species Human (GRCh38)
Location 5:173785687-173785709
Sequence CTGGTAAGAAGCTAAAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001711889_1001711893 19 Left 1001711889 5:173785687-173785709 CCATCACTTTAGCTTCTTACCAG No data
Right 1001711893 5:173785729-173785751 TACTTCATCACTGGCTGACAAGG No data
1001711889_1001711891 10 Left 1001711889 5:173785687-173785709 CCATCACTTTAGCTTCTTACCAG No data
Right 1001711891 5:173785720-173785742 TCTACCTAGTACTTCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001711889 Original CRISPR CTGGTAAGAAGCTAAAGTGA TGG (reversed) Intergenic
No off target data available for this crispr