ID: 1001711889 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:173785687-173785709 |
| Sequence | CTGGTAAGAAGCTAAAGTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001711889_1001711893 | 19 | Left | 1001711889 | 5:173785687-173785709 | CCATCACTTTAGCTTCTTACCAG | No data | ||
| Right | 1001711893 | 5:173785729-173785751 | TACTTCATCACTGGCTGACAAGG | No data | ||||
| 1001711889_1001711891 | 10 | Left | 1001711889 | 5:173785687-173785709 | CCATCACTTTAGCTTCTTACCAG | No data | ||
| Right | 1001711891 | 5:173785720-173785742 | TCTACCTAGTACTTCATCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001711889 | Original CRISPR | CTGGTAAGAAGCTAAAGTGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||