ID: 1001712152

View in Genome Browser
Species Human (GRCh38)
Location 5:173787463-173787485
Sequence CTGAGAGATTGCTCAGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001712144_1001712152 3 Left 1001712144 5:173787437-173787459 CCCCATTGGACAGCGCATCCCCT No data
Right 1001712152 5:173787463-173787485 CTGAGAGATTGCTCAGTGATGGG No data
1001712142_1001712152 13 Left 1001712142 5:173787427-173787449 CCCAAGACAACCCCATTGGACAG No data
Right 1001712152 5:173787463-173787485 CTGAGAGATTGCTCAGTGATGGG No data
1001712143_1001712152 12 Left 1001712143 5:173787428-173787450 CCAAGACAACCCCATTGGACAGC No data
Right 1001712152 5:173787463-173787485 CTGAGAGATTGCTCAGTGATGGG No data
1001712146_1001712152 1 Left 1001712146 5:173787439-173787461 CCATTGGACAGCGCATCCCCTGA No data
Right 1001712152 5:173787463-173787485 CTGAGAGATTGCTCAGTGATGGG No data
1001712145_1001712152 2 Left 1001712145 5:173787438-173787460 CCCATTGGACAGCGCATCCCCTG No data
Right 1001712152 5:173787463-173787485 CTGAGAGATTGCTCAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001712152 Original CRISPR CTGAGAGATTGCTCAGTGAT GGG Intergenic