ID: 1001720020

View in Genome Browser
Species Human (GRCh38)
Location 5:173849263-173849285
Sequence TGAGTTCCTACCTGACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001720020_1001720026 29 Left 1001720020 5:173849263-173849285 CCTGGCTGTCAGGTAGGAACTCA No data
Right 1001720026 5:173849315-173849337 CTCCCTGTGGTCTTTCTATGTGG No data
1001720020_1001720025 16 Left 1001720020 5:173849263-173849285 CCTGGCTGTCAGGTAGGAACTCA No data
Right 1001720025 5:173849302-173849324 GAGCTTCTCAGTTCTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001720020 Original CRISPR TGAGTTCCTACCTGACAGCC AGG (reversed) Intergenic
No off target data available for this crispr