ID: 1001721856

View in Genome Browser
Species Human (GRCh38)
Location 5:173863415-173863437
Sequence CAATATGAGATGGGGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001721856_1001721865 28 Left 1001721856 5:173863415-173863437 CCATCTGACCCCATCTCATATTG No data
Right 1001721865 5:173863466-173863488 GGAGAATATCCATGAGTGCTTGG No data
1001721856_1001721863 6 Left 1001721856 5:173863415-173863437 CCATCTGACCCCATCTCATATTG No data
Right 1001721863 5:173863444-173863466 GGGTTTAACGTAGACTTGAAGGG No data
1001721856_1001721864 7 Left 1001721856 5:173863415-173863437 CCATCTGACCCCATCTCATATTG No data
Right 1001721864 5:173863445-173863467 GGTTTAACGTAGACTTGAAGGGG No data
1001721856_1001721862 5 Left 1001721856 5:173863415-173863437 CCATCTGACCCCATCTCATATTG No data
Right 1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001721856 Original CRISPR CAATATGAGATGGGGTCAGA TGG (reversed) Intergenic