ID: 1001721857

View in Genome Browser
Species Human (GRCh38)
Location 5:173863423-173863445
Sequence CCATTGTTCAATATGAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001721857_1001721864 -1 Left 1001721857 5:173863423-173863445 CCCCATCTCATATTGAACAATGG No data
Right 1001721864 5:173863445-173863467 GGTTTAACGTAGACTTGAAGGGG No data
1001721857_1001721865 20 Left 1001721857 5:173863423-173863445 CCCCATCTCATATTGAACAATGG No data
Right 1001721865 5:173863466-173863488 GGAGAATATCCATGAGTGCTTGG No data
1001721857_1001721863 -2 Left 1001721857 5:173863423-173863445 CCCCATCTCATATTGAACAATGG No data
Right 1001721863 5:173863444-173863466 GGGTTTAACGTAGACTTGAAGGG No data
1001721857_1001721862 -3 Left 1001721857 5:173863423-173863445 CCCCATCTCATATTGAACAATGG No data
Right 1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001721857 Original CRISPR CCATTGTTCAATATGAGATG GGG (reversed) Intergenic