ID: 1001721861 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:173863425-173863447 |
| Sequence | ACCCATTGTTCAATATGAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1001721861_1001721862 | -5 | Left | 1001721861 | 5:173863425-173863447 | CCATCTCATATTGAACAATGGGT | No data | ||
| Right | 1001721862 | 5:173863443-173863465 | TGGGTTTAACGTAGACTTGAAGG | No data | ||||
| 1001721861_1001721863 | -4 | Left | 1001721861 | 5:173863425-173863447 | CCATCTCATATTGAACAATGGGT | No data | ||
| Right | 1001721863 | 5:173863444-173863466 | GGGTTTAACGTAGACTTGAAGGG | No data | ||||
| 1001721861_1001721865 | 18 | Left | 1001721861 | 5:173863425-173863447 | CCATCTCATATTGAACAATGGGT | No data | ||
| Right | 1001721865 | 5:173863466-173863488 | GGAGAATATCCATGAGTGCTTGG | No data | ||||
| 1001721861_1001721864 | -3 | Left | 1001721861 | 5:173863425-173863447 | CCATCTCATATTGAACAATGGGT | No data | ||
| Right | 1001721864 | 5:173863445-173863467 | GGTTTAACGTAGACTTGAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1001721861 | Original CRISPR | ACCCATTGTTCAATATGAGA TGG (reversed) | Intergenic | ||