ID: 1001721862

View in Genome Browser
Species Human (GRCh38)
Location 5:173863443-173863465
Sequence TGGGTTTAACGTAGACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001721859_1001721862 -4 Left 1001721859 5:173863424-173863446 CCCATCTCATATTGAACAATGGG No data
Right 1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG No data
1001721857_1001721862 -3 Left 1001721857 5:173863423-173863445 CCCCATCTCATATTGAACAATGG No data
Right 1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG No data
1001721861_1001721862 -5 Left 1001721861 5:173863425-173863447 CCATCTCATATTGAACAATGGGT No data
Right 1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG No data
1001721856_1001721862 5 Left 1001721856 5:173863415-173863437 CCATCTGACCCCATCTCATATTG No data
Right 1001721862 5:173863443-173863465 TGGGTTTAACGTAGACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001721862 Original CRISPR TGGGTTTAACGTAGACTTGA AGG Intergenic