ID: 1001721878

View in Genome Browser
Species Human (GRCh38)
Location 5:173863571-173863593
Sequence ACACATGCAGAGGCTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001721874_1001721878 22 Left 1001721874 5:173863526-173863548 CCAGCACCATCAATTGATAGGTT No data
Right 1001721878 5:173863571-173863593 ACACATGCAGAGGCTCTGCTGGG No data
1001721875_1001721878 16 Left 1001721875 5:173863532-173863554 CCATCAATTGATAGGTTCAGAGA No data
Right 1001721878 5:173863571-173863593 ACACATGCAGAGGCTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001721878 Original CRISPR ACACATGCAGAGGCTCTGCT GGG Intergenic
No off target data available for this crispr