ID: 1001722308

View in Genome Browser
Species Human (GRCh38)
Location 5:173866832-173866854
Sequence TATCTCACCCCCTTTTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001722308_1001722315 24 Left 1001722308 5:173866832-173866854 CCAACACAAAAGGGGGTGAGATA No data
Right 1001722315 5:173866879-173866901 GTATGAAACATACTGGGGCAAGG No data
1001722308_1001722312 19 Left 1001722308 5:173866832-173866854 CCAACACAAAAGGGGGTGAGATA No data
Right 1001722312 5:173866874-173866896 ACCCAGTATGAAACATACTGGGG No data
1001722308_1001722311 18 Left 1001722308 5:173866832-173866854 CCAACACAAAAGGGGGTGAGATA No data
Right 1001722311 5:173866873-173866895 AACCCAGTATGAAACATACTGGG No data
1001722308_1001722310 17 Left 1001722308 5:173866832-173866854 CCAACACAAAAGGGGGTGAGATA No data
Right 1001722310 5:173866872-173866894 AAACCCAGTATGAAACATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001722308 Original CRISPR TATCTCACCCCCTTTTGTGT TGG (reversed) Intergenic
No off target data available for this crispr