ID: 1001722311

View in Genome Browser
Species Human (GRCh38)
Location 5:173866873-173866895
Sequence AACCCAGTATGAAACATACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001722308_1001722311 18 Left 1001722308 5:173866832-173866854 CCAACACAAAAGGGGGTGAGATA No data
Right 1001722311 5:173866873-173866895 AACCCAGTATGAAACATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001722311 Original CRISPR AACCCAGTATGAAACATACT GGG Intergenic
No off target data available for this crispr