ID: 1001724529

View in Genome Browser
Species Human (GRCh38)
Location 5:173885931-173885953
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001724529_1001724532 15 Left 1001724529 5:173885931-173885953 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 1001724532 5:173885969-173885991 CTTTATAAATTACCCAGTCTTGG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
1001724529_1001724533 16 Left 1001724529 5:173885931-173885953 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 1001724533 5:173885970-173885992 TTTATAAATTACCCAGTCTTGGG 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001724529 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr