ID: 1001726689

View in Genome Browser
Species Human (GRCh38)
Location 5:173908562-173908584
Sequence CTGCATGATGAGATGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001726685_1001726689 2 Left 1001726685 5:173908537-173908559 CCACTCAGCGCACATTACTGAAT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1001726689 5:173908562-173908584 CTGCATGATGAGATGGGGTCAGG 0: 1
1: 0
2: 1
3: 18
4: 222
1001726684_1001726689 28 Left 1001726684 5:173908511-173908533 CCTCAAGTTGCAGTGGTATTATA 0: 1
1: 1
2: 0
3: 9
4: 107
Right 1001726689 5:173908562-173908584 CTGCATGATGAGATGGGGTCAGG 0: 1
1: 0
2: 1
3: 18
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001726689 Original CRISPR CTGCATGATGAGATGGGGTC AGG Intronic
900385768 1:2409932-2409954 CTACATGCTGAGCTGGGGTTGGG + Intronic
900906985 1:5566169-5566191 TTTCATTATGGGATGGGGTCAGG - Intergenic
901128256 1:6944445-6944467 CTGCAGGACGTGATGGGGTGGGG - Intronic
903761856 1:25703989-25704011 CTGGATGATGGGATGGGCTTGGG - Intronic
903780078 1:25815365-25815387 CAGGGTGATGAGATGGTGTCGGG + Intronic
904889943 1:33772209-33772231 CTGCTGGATTAGATGGTGTCAGG + Intronic
905076309 1:35273979-35274001 CTTCATGATGTGATGGGATATGG + Intronic
906151182 1:43588574-43588596 GTGGATGATGAGCTGGGGTCTGG + Intronic
906873352 1:49509104-49509126 CTTCAGGATGAGGTGGGGGCAGG + Intronic
907838616 1:58134978-58135000 CTTCATGTGGAGATGAGGTCTGG + Intronic
909611272 1:77554158-77554180 CTGCATGGGGTGATGGGGGCAGG - Intronic
911007819 1:93244972-93244994 CTGCATGATGAGGTAGTGACTGG - Intronic
911267564 1:95761553-95761575 CTGCAAGATGAGATTCGGGCGGG + Intergenic
913647815 1:120877514-120877536 CTACAAGATGAGATTGGGTGTGG - Intergenic
913698111 1:121347572-121347594 CAGCAAGTTGAGATGGGGTCAGG - Intronic
914078817 1:144385334-144385356 CTACAAGATGAGATTGGGTGTGG + Intergenic
914100362 1:144581168-144581190 CTACAAGATGAGATTGGGTGTGG - Intergenic
914139439 1:144932480-144932502 CAGCAAGTTGAGATGGGGTCAGG + Intronic
914173723 1:145253879-145253901 CTACAAGATGAGATTGGGTGTGG + Intergenic
914298629 1:146356514-146356536 CTACAAGATGAGATTGGGTGTGG + Intergenic
914528382 1:148495065-148495087 CTACAAGATGAGATTGGGTGTGG + Intergenic
914638009 1:149572040-149572062 CTACAAGATGAGATTGGGTGTGG - Intergenic
914675804 1:149906492-149906514 CTGCAGGATGGGGTGGGGACTGG - Intronic
915228963 1:154431647-154431669 CTGCATGATGGGATGAAGTGAGG + Intronic
916738896 1:167631144-167631166 CTGCCTGCTGAGAGGAGGTCCGG + Intronic
917862917 1:179165101-179165123 CTACATGATGAGATGAAGTGAGG + Intronic
918511678 1:185319457-185319479 CTACATGATGAGATGAAGTGAGG - Intergenic
920485506 1:206366222-206366244 CAGCAAGTTGAGATGGGGTCAGG - Intronic
923045082 1:230349900-230349922 CTTCAGGTTGAGTTGGGGTCAGG - Intronic
923179063 1:231498636-231498658 GTTCATGATGAGATTGGGTGGGG + Intergenic
924558017 1:245133734-245133756 CTGCAAGATGAAATGAGCTCTGG + Intergenic
924954433 1:248913158-248913180 GTGGAAGATGAGATGGGGTGAGG - Intronic
1062848391 10:725483-725505 CTGCAAGATGAGATCAGTTCCGG + Intergenic
1067315738 10:45160281-45160303 CTGTGTGATGAGATGAAGTCAGG + Intergenic
1069861823 10:71476231-71476253 CTGCATGAAGGGGTGGGGACGGG - Intronic
1071371041 10:84952247-84952269 CTAAATGGAGAGATGGGGTCTGG + Intergenic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1074779470 10:116790663-116790685 CTAGACAATGAGATGGGGTCTGG - Intergenic
1075462321 10:122625184-122625206 CTAAGTGATGAGATGGGGACAGG + Intronic
1079097408 11:17519914-17519936 TGGCATGTTGTGATGGGGTCTGG - Intronic
1079244894 11:18744714-18744736 CTGCACGATGAGAGGGGCTGGGG + Intronic
1080427337 11:32168347-32168369 CTGTCCGATGAGATGGGGTCAGG + Intergenic
1083856016 11:65393550-65393572 CTGCAGGACGAGATGGGGAGTGG - Intronic
1084667074 11:70582216-70582238 CCTCATGATGAGAAGGGGCCTGG + Intronic
1087753439 11:102030002-102030024 CTGCTTCATGACATGAGGTCTGG + Intergenic
1088654386 11:111985516-111985538 CAGCATGTTGAAATAGGGTCTGG - Intronic
1088702050 11:112422128-112422150 CTGCCTGATGAAATGGGAACTGG - Intergenic
1089865160 11:121625256-121625278 CTGTACGATGAGCTGGGGTCTGG + Exonic
1092173387 12:6387138-6387160 ATGCATTATGACATGGGCTCTGG - Intronic
1094063583 12:26340611-26340633 GTGAATGATGAGGTGGGGTCTGG + Intronic
1095461528 12:42449409-42449431 CTGCATGGTGAGATGAAGTGAGG - Intronic
1097504309 12:60445614-60445636 CTACAGGATGGGTTGGGGTCTGG - Intergenic
1097819176 12:64110342-64110364 ATGCATGATGAGTTAGGTTCAGG - Intronic
1098392330 12:69982692-69982714 CACCATGATGAGAAGGAGTCTGG - Intergenic
1098715341 12:73822581-73822603 CTGCAAGATGAGATCAGGTGGGG + Intergenic
1101443573 12:104721174-104721196 ATGCCTGATGAGATGGGGATGGG - Intronic
1101596989 12:106176720-106176742 CTACATGATGAGATGAAGTAAGG + Intergenic
1104147655 12:126050947-126050969 CTGAATGATGAGAAGGATTCGGG - Intergenic
1104199725 12:126576918-126576940 CAGGATGCTGAGATGAGGTCTGG + Intergenic
1104979339 12:132566820-132566842 CTGCATTATGTGCTGGGGACTGG - Intronic
1105727502 13:23178870-23178892 GAGCTTGATGAGATGGTGTCAGG + Intergenic
1111929950 13:94502816-94502838 CTGCATGAGCAGATGTGGTCTGG - Intergenic
1112467119 13:99654150-99654172 CTGATTGATGGGATGTGGTCAGG - Intronic
1113423570 13:110188896-110188918 CTGCTTGATGGGATTGGGCCAGG - Intronic
1114304410 14:21408520-21408542 CTGGCTGATGAGATGGGATTGGG - Exonic
1115468016 14:33737437-33737459 TTGCATGATTCGATGGGATCTGG - Intronic
1115801845 14:37003309-37003331 CTACATGATGAGATGAAGTGAGG + Intronic
1115993118 14:39170046-39170068 CTCCATAACGAGATGGTGTCTGG - Exonic
1118130963 14:62963054-62963076 CTACATGATGAGATGAAGTAGGG - Intronic
1122862145 14:104587499-104587521 TTGCGTGAAGAGACGGGGTCAGG + Intronic
1123917810 15:25050138-25050160 CTGCAGGATGGGATGGTGCCTGG + Intergenic
1124143197 15:27095857-27095879 CTGCATGCAGAGAAGGGATCAGG - Intronic
1126103060 15:45130904-45130926 GTGCATGAAGAGCTGGGCTCTGG - Intronic
1126742954 15:51796784-51796806 CTGTATGATGAGATGAAGTGAGG + Intronic
1127331472 15:57943969-57943991 CTGCAGGAGGAGAGAGGGTCTGG + Intergenic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1131806424 15:96126997-96127019 CTACAGGATGAGATGGGATGGGG - Intergenic
1134288369 16:12882241-12882263 CTCCATTTTGGGATGGGGTCTGG - Intergenic
1135421792 16:22309713-22309735 CTGCCTGACCAGATGGGGTGGGG + Intronic
1135918432 16:26626393-26626415 CTGCCTGGTCAGATGGGCTCAGG + Intergenic
1136178310 16:28533703-28533725 GAGCCTCATGAGATGGGGTCGGG + Intronic
1136632124 16:31495178-31495200 CCTCATGATGAGTTGGGGGCAGG - Intronic
1138424924 16:56925145-56925167 TTGCATTCTGAGATGGGGACAGG - Intergenic
1140522164 16:75591088-75591110 CTGCCTCCTGAGATGGTGTCTGG - Intergenic
1141730504 16:85819840-85819862 CTGCAAGAAGAGATGCGGGCAGG - Intergenic
1145763750 17:27443768-27443790 CTCCATGCTGAGATGGGATAAGG + Intergenic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1147938015 17:44024637-44024659 CTGCATGAAGGGCTGGGGTGAGG + Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148964082 17:51420053-51420075 CTGCATGAAGAGATGTGGTTGGG - Intergenic
1149832638 17:59885210-59885232 CCGGATGATGACATGGGGTATGG + Intronic
1150632419 17:66889348-66889370 CTGCATGCAGAGCTGGGGTGGGG + Intergenic
1151441902 17:74135064-74135086 CTGCAAGATGAAAAGGGTTCTGG - Intergenic
1151824918 17:76518922-76518944 GTGCAGGAGGACATGGGGTCAGG - Intergenic
1152080605 17:78185166-78185188 CTGCAAGAGGAGAGAGGGTCAGG + Intronic
1153140293 18:1964522-1964544 GGGCATGATGAAATGGGGCCTGG + Intergenic
1156472833 18:37388263-37388285 TTGCGTGAAGAGATGGGGTAGGG + Intronic
1156479592 18:37427589-37427611 ATGCAAGAGGAGATGAGGTCAGG - Intronic
1158020559 18:52836749-52836771 GTGCATGCTGTCATGGGGTCTGG + Intronic
1158341937 18:56475576-56475598 CTGCCTGATGAGATAAGGTGAGG - Intergenic
1158894782 18:61902642-61902664 CTGCATGATGCTGTGGGGTGTGG - Intergenic
1161874147 19:6894587-6894609 CTGAATGATGTGGTTGGGTCTGG + Intronic
1161971326 19:7582524-7582546 CTGCATGCTGAGATGGGGACAGG - Intergenic
1162217630 19:9149534-9149556 CTGAAGGATGAGAGGGGGCCAGG + Intronic
1164391687 19:27828513-27828535 CTGCATGCAGAGATGTGTTCAGG - Intergenic
1164628068 19:29742637-29742659 CTCTGTGATGAGATGGGGTGAGG - Intergenic
1166138151 19:40790013-40790035 GTACAGCATGAGATGGGGTCAGG + Intronic
1166318527 19:42002528-42002550 CTGGATGCAGAGCTGGGGTCTGG + Intronic
1168429728 19:56268751-56268773 CTGCTTAGTGAGATGGGGTGAGG - Intronic
925182633 2:1827019-1827041 CTGCAGGATGGGGAGGGGTCTGG - Intronic
925706168 2:6686127-6686149 CTGCATGATCACCTGGGGCCTGG + Intergenic
925736892 2:6971482-6971504 TTGCATTTTGAGGTGGGGTCTGG + Intronic
926425487 2:12735456-12735478 CTGCTTGAGTAGGTGGGGTCAGG + Intronic
926841907 2:17090067-17090089 TTGCAAGGTGAGGTGGGGTCAGG + Intergenic
927056511 2:19370378-19370400 GGGCATGATGAGATTGGTTCTGG - Intergenic
927991999 2:27454441-27454463 GTGCATGATGAGAAGGAGACTGG + Intronic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
931295804 2:60923978-60924000 CTGCATGAGGAGGTGGGATATGG - Exonic
931474537 2:62573879-62573901 CTACATGATGAGATGAAGTGAGG - Intergenic
932525213 2:72458853-72458875 CAGCATGATGAAATGGGGACAGG + Intronic
932813276 2:74841966-74841988 CTGTTTGATGAGCTGGAGTCAGG + Intronic
936245862 2:110826948-110826970 CTCCATGGTGAGATGTGGTGTGG + Intronic
936270203 2:111043244-111043266 CTGCACGTTGAGATGTGGTGGGG - Intronic
937685116 2:124687264-124687286 CTGCATTATAAGAGGGAGTCTGG + Intronic
938015070 2:127859997-127860019 CTGCACCATGTGCTGGGGTCTGG + Intergenic
938106448 2:128534212-128534234 CTACATGATGAGATGAAGTGAGG - Intergenic
938408280 2:131044732-131044754 CTGTATCATGGGATGCGGTCAGG - Intronic
939458479 2:142468044-142468066 CTACATGATGAGATGAAGTGAGG - Intergenic
940016893 2:149116063-149116085 CTACATGATGAGATGGAATGAGG - Intronic
942896016 2:181055437-181055459 CGGCAAGATGGGAAGGGGTCAGG - Intronic
948100650 2:235370146-235370168 CAGCTTCATGAGCTGGGGTCAGG - Intergenic
1168969233 20:1919483-1919505 CTGTATCATAAGAGGGGGTCTGG - Intronic
1170199291 20:13725145-13725167 CTGCATGAGCAGATAGGGTAGGG - Intronic
1171175863 20:23050397-23050419 CCACCCGATGAGATGGGGTCTGG - Intergenic
1173331001 20:42076265-42076287 CTTCATGAGCAGCTGGGGTCTGG - Exonic
1174200812 20:48805281-48805303 CTGGGTGATGAGTTGGGGTGGGG - Intronic
1177349802 21:19922563-19922585 CTAGATGATGAAATGGGTTCTGG - Intergenic
1177854929 21:26390154-26390176 GAGCATGATGAGGTGGGGTGGGG - Intergenic
1179809202 21:43859453-43859475 TTGCAGGAGGAGATGGGGTCTGG + Intergenic
1181570521 22:23765767-23765789 CTGGCTGATGAGGTGGGGTCAGG - Exonic
1181646425 22:24233673-24233695 CTGCATTATGAGATGGACTCTGG + Intronic
1181785483 22:25223758-25223780 CTGGATGAAAAGATGGGCTCAGG - Intronic
1182328317 22:29531240-29531262 CTGTCTGATGAGGTGGGGTGGGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182985494 22:34712391-34712413 ATGCTTGATGAGAAGGGGCCAGG - Intergenic
1183272248 22:36869528-36869550 CAGCAGGATGAGGTGGGGTCGGG - Intronic
1184704638 22:46202205-46202227 CTGCATGAGGACCAGGGGTCAGG - Intronic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
950252233 3:11475407-11475429 CTGCATGATGGGCAGGGGGCTGG + Intronic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951915481 3:27796669-27796691 CTACATGATGAGATGCAGTGAGG - Intergenic
952945738 3:38477065-38477087 CTGCAGAATGAGGTGGGGGCTGG + Intronic
954225656 3:49179232-49179254 GGGCATGCTGAGATGTGGTCTGG - Intronic
954328533 3:49876949-49876971 CTCCATGATGAGATGTTGTTGGG + Intergenic
954977856 3:54713618-54713640 CCGCAGGATGAGATGAGGTCTGG + Intronic
956683529 3:71803634-71803656 CTGCAGGATCAGGTGGAGTCTGG + Intergenic
959159467 3:102706146-102706168 CTGAATGATCTGATGAGGTCTGG + Intergenic
960953172 3:123012685-123012707 ATGCATGATGAGAGGAGGTGAGG - Intronic
961673813 3:128552866-128552888 CTGCATGATGTGATGAGAGCAGG + Intergenic
962268543 3:133961047-133961069 GTGCATGATGGGAAGGGGCCTGG + Intronic
962869009 3:139472091-139472113 CTCCATGCAGAGATGGAGTCAGG - Intronic
962945864 3:140169822-140169844 CAGGATCATGAGATGGGGTAGGG + Intronic
964071867 3:152645260-152645282 CTACATGATGAGATGAAGTGAGG + Intergenic
964629378 3:158793543-158793565 CTACATGATGAGATGAAGTGAGG - Intronic
966283896 3:178270168-178270190 CAGCATGATGAGATGAGATGGGG + Intergenic
966930182 3:184671120-184671142 CTCCATGATGAAGTGGGGTATGG + Intronic
966930292 3:184671575-184671597 CTCCATGATGAAGTGGGGTATGG + Intronic
966930338 3:184671763-184671785 CCCCATGATGAAATGGGGTATGG + Intronic
968426853 4:529349-529371 CTGGCTGAGGAGCTGGGGTCAGG - Intronic
968651247 4:1761119-1761141 CTGCATGGTGGGAGGGGGCCCGG - Intergenic
968800745 4:2742031-2742053 CTGGAGGTGGAGATGGGGTCAGG - Exonic
969240174 4:5892430-5892452 TTGCATGATGAGGTGGGGGAGGG + Intronic
969396802 4:6927051-6927073 CTGCTTGATGAGGTGGGAGCAGG + Intronic
969452937 4:7285326-7285348 CAACATGAGGAGATGGGGCCGGG - Intronic
970552146 4:17193070-17193092 CTGGAAGATCAGCTGGGGTCTGG - Intergenic
973095835 4:46198193-46198215 CTGAATGATGAGAAGGTGTTGGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
980725284 4:136750943-136750965 CTACATGATGAGATGAAGTGAGG + Intergenic
981404089 4:144347063-144347085 GTGCAAGAAGAGATGGGGGCTGG - Intergenic
981537288 4:145813231-145813253 CTACATGATGAGATGAAGTGAGG - Intronic
981698264 4:147580698-147580720 CTCAATGTTGAGGTGGGGTCTGG - Intergenic
986324390 5:6661048-6661070 CTTCAAGATGAGATTGGGTGGGG + Intronic
987027089 5:13938317-13938339 CTGCATAATGAGATGAAGTGAGG - Intronic
987811763 5:22845848-22845870 CTGTGTAATGAGTTGGGGTCGGG + Intronic
989979073 5:50620915-50620937 CTACAAGATGAGATTGGGTGTGG - Intergenic
993791143 5:92212626-92212648 CTACAAGATGAGATTGGGTGGGG + Intergenic
997675155 5:135707249-135707271 CTGGCTTATCAGATGGGGTCAGG - Intergenic
997834052 5:137178082-137178104 CTGGATGGTGAGATGGGCTAGGG - Intronic
999125245 5:149241463-149241485 CTGAAAGATGAGAAGGGGCCTGG + Intronic
999449683 5:151668627-151668649 CTTCATCATCAGCTGGGGTCTGG + Intronic
1001383887 5:171322095-171322117 CTGCTTGGTGAGAAGAGGTCAGG + Intergenic
1001726689 5:173908562-173908584 CTGCATGATGAGATGGGGTCAGG + Intronic
1002569979 5:180134726-180134748 CTGGGTGAAGAGATGGGGACAGG - Intronic
1004017390 6:11744573-11744595 CTACATTCTGAGATGGGGCCAGG + Intronic
1006154369 6:32006343-32006365 CTGCAGGAGGAGCTGGGGGCTGG - Intergenic
1006160676 6:32039071-32039093 CTGCAGGAGGAGGTGGGGGCTGG - Intronic
1006525310 6:34599614-34599636 CTAAATGATGAGAGGAGGTCAGG - Intronic
1007246748 6:40468776-40468798 ATGCATGAGGAGATGGGGTAAGG - Intronic
1007447034 6:41914770-41914792 TTGAGTGATGAGATGGGGTGTGG - Intronic
1007687080 6:43673378-43673400 GTACATGAAGAGATGGGGTATGG + Intronic
1008157703 6:48037106-48037128 CTACATGATGAGATGAAGTGAGG - Intronic
1008229553 6:48968162-48968184 TTGCATGAGGACATGGGCTCTGG - Intergenic
1008642421 6:53478196-53478218 TTGCAAGATGAAATGGGTTCTGG - Intergenic
1010951332 6:82040506-82040528 CTGCATACTGAGTGGGGGTCTGG - Intergenic
1012990544 6:105921635-105921657 CTACATGATGAGATGAAGTGAGG + Intergenic
1013611687 6:111801962-111801984 TTGAATGCTGAGATGGTGTCTGG - Intronic
1019572744 7:1720542-1720564 CTGCCTGGTTAGATGGGGCCCGG - Intronic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1021394595 7:20131710-20131732 CTACATGATGAGATGAAGTGAGG + Intergenic
1022320869 7:29286434-29286456 CTGCATGTGGGGATGGGGTGGGG + Intronic
1025868771 7:65410800-65410822 CTGCATGCAGAGATGTGTTCAGG + Intergenic
1028575369 7:92343652-92343674 ATGTATTTTGAGATGGGGTCTGG - Intronic
1030090543 7:105854066-105854088 CTGCCTGCAGAGATGGGCTCTGG - Intronic
1031973442 7:128079473-128079495 CTGGAAGGTGAGAAGGGGTCAGG + Intronic
1034539186 7:151745224-151745246 TTGCATAATGAGATGTGGTTTGG - Intronic
1035218004 7:157384613-157384635 CTGCATGAGGAGAGGGGGAGGGG + Intronic
1035560990 8:603208-603230 CTGGGTGTTGAGGTGGGGTCTGG - Intergenic
1035980009 8:4360026-4360048 CTGTATGCTCAGATGGGGACAGG - Intronic
1042776900 8:72442004-72442026 CTTCCTTATGAGAGGGGGTCTGG - Intergenic
1044743585 8:95351582-95351604 GTTCATGATGTGATGGGGGCGGG + Intergenic
1045036170 8:98178196-98178218 CTGCATGAGCAGATGGGAACTGG - Intergenic
1046455221 8:114450437-114450459 CAACATGATGAGATGAGGTAAGG + Intergenic
1049106788 8:140619019-140619041 CGGCATGATGGGGAGGGGTCAGG + Intronic
1055012432 9:71581426-71581448 ATGCATGATGTGATGGGATGAGG - Intergenic
1055044358 9:71910238-71910260 GTGGATGAAAAGATGGGGTCAGG - Intronic
1058380002 9:104367197-104367219 CTGGATAATGAGCTGGGTTCTGG - Intergenic
1058632946 9:107008130-107008152 CTGCATAATGAGAGGGGGGTGGG - Intronic
1058787485 9:108404575-108404597 GGGGAAGATGAGATGGGGTCAGG - Intergenic
1058939614 9:109801032-109801054 CTGGATGGTGAGTTGGGGTTGGG + Intronic
1061204528 9:129155308-129155330 CTGCTTGGTGAGATTGGGCCTGG + Intergenic
1061531807 9:131219913-131219935 CTGCAGGATGATATGGGGCCTGG + Intronic
1061613365 9:131763152-131763174 TTGTTTGAGGAGATGGGGTCTGG - Intergenic
1062466834 9:136685321-136685343 CTCCAAGCTGAGATGGGGACAGG + Intronic
1185739921 X:2523532-2523554 CTTCATGATTAGATGGGGTTTGG - Intergenic
1188683567 X:33041958-33041980 CTATATGATGGGATGGGGTTGGG - Intronic
1189278805 X:39806460-39806482 CTGCATGCTGAGATGGAGAGGGG + Intergenic
1189417949 X:40831615-40831637 CTGGAGGTGGAGATGGGGTCAGG - Intergenic
1190709277 X:53054716-53054738 CTGGATGGTGAGATAGGGTGGGG + Intronic
1193940864 X:87679713-87679735 CTGCCTGATCACATGAGGTCAGG - Intergenic
1197304029 X:124818877-124818899 CTGCATGATAAAATTGGTTCAGG + Intronic
1197638363 X:128941633-128941655 CTGAATGATAAGATGAGGTTTGG - Intergenic
1201359315 Y:13129035-13129057 CTGCAAGAAGAGATGGGGCTTGG + Intergenic