ID: 1001726861

View in Genome Browser
Species Human (GRCh38)
Location 5:173910777-173910799
Sequence TCACGATGGCTCCACTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001726861_1001726866 21 Left 1001726861 5:173910777-173910799 CCTCTATAGTGGAGCCATCGTGA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1001726866 5:173910821-173910843 GAGTACTAATTGCCAAGAATGGG No data
1001726861_1001726865 20 Left 1001726861 5:173910777-173910799 CCTCTATAGTGGAGCCATCGTGA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1001726865 5:173910820-173910842 TGAGTACTAATTGCCAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001726861 Original CRISPR TCACGATGGCTCCACTATAG AGG (reversed) Intronic