ID: 1001726861

View in Genome Browser
Species Human (GRCh38)
Location 5:173910777-173910799
Sequence TCACGATGGCTCCACTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001726861_1001726865 20 Left 1001726861 5:173910777-173910799 CCTCTATAGTGGAGCCATCGTGA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1001726865 5:173910820-173910842 TGAGTACTAATTGCCAAGAATGG No data
1001726861_1001726866 21 Left 1001726861 5:173910777-173910799 CCTCTATAGTGGAGCCATCGTGA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1001726866 5:173910821-173910843 GAGTACTAATTGCCAAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001726861 Original CRISPR TCACGATGGCTCCACTATAG AGG (reversed) Intronic
902122801 1:14182126-14182148 ACACGATGACTACACGATAGGGG - Intergenic
905349784 1:37337522-37337544 TCCCCATGGCTCCACTGAAGGGG + Intergenic
906238703 1:44228294-44228316 TGACGATGGTTCCACAATAAGGG + Intronic
906952635 1:50347245-50347267 TCATGATGCCTCCAGTCTAGTGG - Intergenic
912014463 1:105015966-105015988 TAAACAGGGCTCCACTATAGTGG - Intergenic
1072279216 10:93850882-93850904 TCAGGATGGCTCGACTCTGGGGG + Intergenic
1074577100 10:114680588-114680610 TCACCATGGCTCCAGTATGAAGG - Intronic
1078774437 11:14381388-14381410 TCATGATGGCTCCGCTGCAGCGG - Intergenic
1081426036 11:42927313-42927335 TTACCATGGCCCCAGTATAGTGG - Intergenic
1103497977 12:121377640-121377662 TATCTATGGCTCCACTATATTGG + Intronic
1108129020 13:47276986-47277008 TCACGATGGCTACACCAAAGGGG + Intergenic
1114312717 14:21482164-21482186 TCAGGTTGGCTCTAATATAGTGG + Intronic
1117647797 14:57870458-57870480 TCATGATAGTTCCACTATATAGG - Intronic
1127976442 15:64000702-64000724 TCAAGATGGCTGCACAGTAGAGG + Intronic
1132011023 15:98276790-98276812 TCACGATGGCTCTACTGTTGTGG - Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136519390 16:30786505-30786527 TCGCGATGGCCCCACTGCAGAGG + Intronic
1141530433 16:84642895-84642917 TCACGACGGCTCCATGAGAGAGG + Intergenic
1149436053 17:56634286-56634308 TCACGAGGGCTCCAATATCACGG + Intergenic
1152307544 17:79530050-79530072 TCACGCTGGCTCCTCCATGGCGG - Intergenic
1157676807 18:49574741-49574763 TCACGGTGGCTGCAAAATAGAGG + Intronic
1165511581 19:36269375-36269397 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165512132 19:36271898-36271920 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165512680 19:36274397-36274419 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165513231 19:36276940-36276962 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165513786 19:36279493-36279515 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165514335 19:36282027-36282049 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165514889 19:36284566-36284588 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165515441 19:36287097-36287119 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165515991 19:36289635-36289657 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165516542 19:36292170-36292192 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165517094 19:36294698-36294720 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165517646 19:36297221-36297243 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165518199 19:36299756-36299778 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165518750 19:36302291-36302313 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165519298 19:36304821-36304843 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165519847 19:36307336-36307358 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165520400 19:36309867-36309889 TCACAAGGGCTCCACTTTTGGGG - Intergenic
1165623673 19:37268716-37268738 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165624217 19:37271255-37271277 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165624763 19:37273783-37273805 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165625305 19:37276321-37276343 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165625834 19:37278845-37278867 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165626378 19:37281373-37281395 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165626918 19:37283898-37283920 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165627460 19:37286422-37286444 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165627996 19:37288946-37288968 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165628537 19:37291472-37291494 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165629078 19:37293997-37294019 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165629620 19:37296523-37296545 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165630162 19:37299050-37299072 TCACAAGGGCTCCACTTTTGGGG + Intergenic
1165630705 19:37301588-37301610 TCACAAGGGCTCCACTTTTGGGG + Intergenic
925799376 2:7583066-7583088 TCACGAAGGCTCCACCTTGGTGG - Intergenic
929238559 2:39629859-39629881 TCAAGATAGCTCAACTAAAGGGG + Intergenic
932135865 2:69228098-69228120 ACAAGCTGGGTCCACTATAGTGG - Intronic
935872192 2:107463174-107463196 ACACAATTGCTCCAATATAGAGG - Intergenic
936347545 2:111686760-111686782 CCACGAGGGCTCCACTCTAATGG + Intergenic
948601476 2:239109823-239109845 TCATGATGATTCCACTGTAGGGG - Intronic
948954792 2:241279954-241279976 TCAGCATGGCTCCACTGCAGCGG - Intronic
1170160445 20:13304739-13304761 TCACAATGGCCCCACTCGAGGGG - Intergenic
1173964101 20:47098754-47098776 TCAGGATGACTCCAATGTAGGGG - Intronic
1179841124 21:44074573-44074595 TCACGATGCATCCACTTTAGTGG + Intronic
953188972 3:40665751-40665773 TTAGTATGGCTGCACTATAGAGG + Intergenic
954545410 3:51430479-51430501 TCACGAGGGCTCCATTATACAGG + Intronic
955206491 3:56900269-56900291 TCTAGATGGTTCCAGTATAGAGG - Intronic
959751388 3:109840398-109840420 TCAAGATGCTTCCACTATGGTGG - Intergenic
967503360 3:190225062-190225084 TTACCATGTCTCAACTATAGAGG + Intergenic
979082211 4:116359142-116359164 CCACTATTGTTCCACTATAGTGG - Intergenic
980358411 4:131742774-131742796 TCACAAGGGCGCCACTATTGGGG - Intergenic
980360030 4:131750212-131750234 TCACAAGGGCGCCACTATTGGGG - Intergenic
981298951 4:143165618-143165640 TCACTCTGGCTACAGTATAGTGG + Intergenic
989768500 5:45114946-45114968 TCAGGATGTCTACACTACAGGGG - Intergenic
991664330 5:68982834-68982856 TGAAGATGGCACCACTAAAGAGG + Intergenic
996850732 5:127948950-127948972 TCATGCTTGCTCCACTATAGGGG + Intergenic
1001726861 5:173910777-173910799 TCACGATGGCTCCACTATAGAGG - Intronic
1002461667 5:179376879-179376901 TCACCGTGGCTCCCTTATAGGGG - Intergenic
1014906112 6:127030367-127030389 TCAATATGGCTCCAAGATAGTGG - Intergenic
1015846177 6:137523013-137523035 TCGCGCTGGCTCCAATAGAGCGG - Intergenic
1017507748 6:155083963-155083985 TCACGTTGGCTGTACTATATAGG + Intronic
1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG + Intronic
1022473037 7:30693368-30693390 TCACGGAGGCTCCATTACAGAGG - Intronic
1026496337 7:70906877-70906899 TCACGATGGCTCCAGTGTGGAGG - Intergenic
1026631924 7:72045152-72045174 TCACCATGGCTCCAGTGAAGCGG + Intronic
1027702168 7:81483270-81483292 TCAGGATGGCTGCAATATGGCGG + Intergenic
1031740634 7:125425766-125425788 TCCTGATGCCTCCATTATAGTGG + Intergenic
1044413997 8:91915611-91915633 TCAAAATGTCTCCACTAAAGTGG + Intergenic
1189273856 X:39770729-39770751 TCAGGATGCTTCCACTCTAGTGG - Intergenic
1190691904 X:52919531-52919553 TCACCAAGGCTGGACTATAGTGG + Intergenic
1190694079 X:52936261-52936283 TCACCAAGGCTGGACTATAGTGG - Intronic
1190950144 X:55135543-55135565 TCAAAATTGCTCCCCTATAGAGG - Intronic
1193503881 X:82315561-82315583 TCACCAGGGCTTCAGTATAGTGG - Intergenic