ID: 1001727770

View in Genome Browser
Species Human (GRCh38)
Location 5:173921496-173921518
Sequence GGAAGCTCCAAAATGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001727770_1001727777 27 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727777 5:173921546-173921568 TGTAGCAGGGTTAAGAATATGGG No data
1001727770_1001727776 26 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727776 5:173921545-173921567 TTGTAGCAGGGTTAAGAATATGG No data
1001727770_1001727773 13 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727773 5:173921532-173921554 CATCTTTATTCCTTTGTAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 235
1001727770_1001727774 14 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727774 5:173921533-173921555 ATCTTTATTCCTTTGTAGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001727770 Original CRISPR GGAAGCTCCAAAATGCTACT TGG (reversed) Intronic
903301000 1:22378759-22378781 GGAATCTCCAAAATGGCACTAGG + Intergenic
906922373 1:50078360-50078382 GGAATTTCCAAAACACTACTTGG + Intronic
911143495 1:94530946-94530968 GGGAGATCCAAAGTGCTACCAGG + Intronic
918479486 1:184962656-184962678 GGAAGCTATCAAATACTACTGGG + Intronic
921354204 1:214270355-214270377 GAAAGCTCTAAAAATCTACTAGG - Intergenic
923116683 1:230946971-230946993 ATAAACTCCAAAATGCTACCAGG + Intronic
1064562982 10:16610981-16611003 TGAAGCCCGTAAATGCTACTTGG + Intronic
1065340115 10:24696633-24696655 GGAGGCTCAAATATACTACTGGG + Intronic
1065405467 10:25358397-25358419 GGGAGCTACAAAATGAGACTTGG - Intronic
1066478107 10:35767667-35767689 AGAAGTTCAAGAATGCTACTAGG - Intergenic
1066641681 10:37560357-37560379 GGAAGCTCTAAACTGCTTCCTGG - Intergenic
1069746039 10:70715645-70715667 GGAAGCTCCCAAATTCTGCTTGG - Intronic
1069783846 10:70975424-70975446 GGCAGCTCCAATATACCACTGGG - Intergenic
1070148013 10:73788779-73788801 GGAAGCTCCAAAAAGCAATTCGG - Exonic
1073645657 10:105299946-105299968 GGAAGCTACAAGATGATATTTGG + Intergenic
1075272073 10:121060907-121060929 GACAGCTCCAACATGCTGCTGGG - Intergenic
1076197549 10:128530587-128530609 TTAAAATCCAAAATGCTACTAGG - Intergenic
1077353815 11:2105515-2105537 GGAAGCTCCAGGGTGCTCCTGGG - Intergenic
1078633179 11:13023952-13023974 AGAACCTCCAAAAAGCCACTTGG - Intergenic
1081714217 11:45237136-45237158 AGTAGCTTAAAAATGCTACTTGG - Intergenic
1082190300 11:49234925-49234947 GTAACATCCAAAATGCTTCTTGG + Intergenic
1082963688 11:58943674-58943696 TGAAGCTCCAAAATGCGAGAGGG - Intronic
1082972765 11:59041194-59041216 TGAAGCTCCAAAATGCAAGAGGG - Intronic
1082977218 11:59085095-59085117 TGAAGCTCCAAAATGCAAGAGGG - Intergenic
1084143214 11:67248325-67248347 GGAATGTCCAAAGTGCTACCAGG + Exonic
1088262054 11:107953526-107953548 AGAAGCTCCAAATGGCTAGTCGG + Intronic
1095437406 12:42205835-42205857 GGATGCACAAAAATGGTACTTGG - Intronic
1097682570 12:62662648-62662670 GGAAGAGCCAAAATTCAACTCGG + Intronic
1098049621 12:66439774-66439796 GGGAGGTTCAAAATGCTTCTGGG - Intronic
1099679296 12:85804826-85804848 GGAATCTCCCCATTGCTACTGGG + Exonic
1101467844 12:104966193-104966215 GCAGGCTCAGAAATGCTACTAGG - Intergenic
1102716237 12:114975496-114975518 CCAAGCTCCAAAATGCTAGAGGG + Intergenic
1107363324 13:39643046-39643068 GGAAGCTCCATAATGCTGAGAGG + Intergenic
1107364352 13:39654599-39654621 GAAAACTTTAAAATGCTACTGGG - Intergenic
1108534522 13:51360261-51360283 GTCAGCTCCAACATGCCACTGGG - Intronic
1111476652 13:88758236-88758258 GGAAGCTCTTAAATACTATTAGG - Intergenic
1112384279 13:98923560-98923582 GAAAGCTCCAAAAAGCTATGTGG + Intronic
1112737841 13:102441242-102441264 AGAAGCTATAAAAAGCTACTAGG - Intergenic
1113297362 13:108973957-108973979 GGATTATCCAAAATGCCACTGGG - Intronic
1114536015 14:23423152-23423174 GGAATTTCAAAAATTCTACTTGG + Intronic
1116803595 14:49468701-49468723 GGAAGCTGAAAAATCCTTCTGGG + Intergenic
1119221906 14:72915585-72915607 GGAAGTTCTAAAATGAGACTGGG - Intergenic
1125355637 15:38814847-38814869 GAAGTCTCAAAAATGCTACTAGG - Intergenic
1126935937 15:53707917-53707939 GGAAGCTCCAAGAGGCTGCTGGG + Intronic
1130106847 15:80935150-80935172 GGAAGGGCCAAGATGCTAATGGG + Intronic
1137077005 16:35980028-35980050 AGAATCTCCAAAATGATATTTGG - Intergenic
1138155244 16:54696946-54696968 GGAAGCACCAACTTGCTGCTGGG - Intergenic
1146506897 17:33413621-33413643 TGAAGATGCAAAAGGCTACTGGG - Intronic
1157931482 18:51828520-51828542 GGAATGTCAAACATGCTACTAGG + Intergenic
1158427292 18:57352016-57352038 GGAAGCTCCAAACAGCAACTGGG - Exonic
930580876 2:53210358-53210380 AGAAGCTCCCAAATGCCCCTAGG + Intergenic
931212699 2:60213108-60213130 GGAAGCTCCCAGAAGCTACTGGG - Intergenic
931856068 2:66303040-66303062 GGAAACTCCAAAATTCTGCAGGG - Intergenic
932676277 2:73784207-73784229 GGAAACCCCAAGATGCTACCAGG - Exonic
932676863 2:73789108-73789130 GGAAACCCCAAGATGCTACCAGG - Intronic
932677448 2:73794005-73794027 GGAAACCCCAAGATGCTACCAGG - Intronic
932678034 2:73798903-73798925 GGAAACCCCAAGATGCTACCAGG - Intronic
932678620 2:73803803-73803825 GGAAACCCCAAGATGCTACCAGG - Intronic
932885603 2:75546634-75546656 GGAAGCTCCTGAATTCTTCTTGG + Intronic
933599644 2:84316500-84316522 GGAAGCTCCAAGATACTAAATGG + Intergenic
935646953 2:105345343-105345365 GGAAGATACAACATGTTACTTGG + Exonic
936764440 2:115829675-115829697 GAAAGCTATAAAATTCTACTAGG - Intronic
939339891 2:140881735-140881757 GGAAAGTCAAAAATGCTTCTGGG - Intronic
941123860 2:161562409-161562431 GGAATCTCCAAGATGAGACTTGG - Intronic
942604209 2:177673433-177673455 GGCAACTCCAAAATCCCACTGGG - Intronic
943825631 2:192387551-192387573 GGAAGCTACAAAATGAGATTTGG + Intergenic
947575310 2:231269136-231269158 GGAAGATTCAATATGCTTCTAGG - Intronic
948521952 2:238545092-238545114 GGATGCTCCAAAATGCCTCTTGG + Intergenic
1170343889 20:15361929-15361951 GGAATCTCCAAAATTTTCCTAGG - Intronic
1170863969 20:20136978-20137000 GCAAGAACCAAAATGTTACTGGG - Intronic
1172740629 20:37163802-37163824 GTAAGCTGAAGAATGCTACTTGG - Intronic
1180666043 22:17513052-17513074 GTCAGCTCCAGAATGCTCCTTGG - Intronic
1182097646 22:27636867-27636889 GGAAGGTCCAAAATTCTCCAGGG + Intergenic
1182893935 22:33843528-33843550 GGAAGATCCAAAATGCATATGGG + Intronic
1184956224 22:47888340-47888362 GTATGGTCCAATATGCTACTTGG + Intergenic
949454795 3:4227134-4227156 AGAAGCTCTAGAATGCTTCTTGG - Intronic
952963569 3:38607701-38607723 GGAAGCTGCACATGGCTACTGGG + Intronic
957024109 3:75160307-75160329 GAAAGCTCCAAAGTACAACTTGG - Intergenic
959806496 3:110561321-110561343 GCAAGATCCACAATGTTACTGGG - Intergenic
960886168 3:122397348-122397370 GGAAGTTCCAAACTCCCACTTGG - Intronic
964544410 3:157817830-157817852 TAAAACTCCAAAATGCCACTGGG + Intergenic
964719250 3:159755507-159755529 GGAAGCTACAAGATGAGACTTGG + Intronic
966442317 3:179959337-179959359 TGAGGCTCCCAAATGCTCCTGGG + Intronic
967449012 3:189601397-189601419 GGAGGCTCCAAAATGACACCTGG - Intergenic
968802664 4:2753555-2753577 GGAAGCTGCAATAAGCTGCTTGG + Intronic
971985452 4:33816788-33816810 GGAAGTTGCAACATTCTACTAGG - Intergenic
972937997 4:44162978-44163000 GAAAGCTCCAAAATATTTCTGGG + Intergenic
973163642 4:47050482-47050504 GAAATTTCCAAAATGCTTCTTGG - Intronic
975539871 4:75497530-75497552 GGTAGCTCCAAAATGATAATAGG - Intronic
980622767 4:135330607-135330629 GGAAGCTCCAAGATATTACTTGG + Intergenic
985200695 4:187482052-187482074 GGAAGCTCCAAACCACAACTGGG - Intergenic
986212143 5:5683988-5684010 GGAAGACCTAAAATGGTACTTGG - Intergenic
989441925 5:41482302-41482324 GGTAGCACCATAATGCAACTTGG - Intronic
989756445 5:44961138-44961160 GGAAGCTCCAAAATGGAATAGGG - Intergenic
990001891 5:50903053-50903075 GGAAGCTACAACAAGCTAATTGG + Intergenic
993693153 5:91027492-91027514 GGAAAGTCAAAAAGGCTACTGGG + Intronic
994128979 5:96202307-96202329 AGGAATTCCAAAATGCTACTGGG - Intergenic
994311439 5:98276578-98276600 GAAAGCTCCAAACTGATATTTGG - Intergenic
995759565 5:115549267-115549289 GAAAGCCACAGAATGCTACTGGG + Intergenic
1001727770 5:173921496-173921518 GGAAGCTCCAAAATGCTACTTGG - Intronic
1002869520 6:1154293-1154315 GGAAAATCCAAAATGGTCCTTGG + Intergenic
1003562994 6:7198993-7199015 GAAAGCTTAATAATGCTACTGGG - Intronic
1004195150 6:13497217-13497239 TTAAGCTCCAAATTTCTACTTGG - Intergenic
1005124425 6:22430150-22430172 GAATGCTACAAAATGCTACATGG - Intergenic
1007266929 6:40603638-40603660 GGAAGCACCAAGAGGGTACTGGG - Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008351498 6:50496900-50496922 GGAAGCTACCAAAGACTACTAGG - Intergenic
1008640968 6:53462441-53462463 GGAAGCTCCAGAAAGATGCTGGG - Intergenic
1012021798 6:93931682-93931704 GAAATCTGCAAAATGCTAATGGG + Intergenic
1017477902 6:154817289-154817311 GGAAAATCCAAAATGCTACTTGG - Intronic
1019349414 7:546956-546978 CCATGCTCCGAAATGCTACTCGG - Intergenic
1020475878 7:8593845-8593867 GGAAGATCCAAAATGTACCTTGG + Intronic
1020660020 7:10971349-10971371 GGAAGCTCCAAATTTTAACTGGG - Intergenic
1021076615 7:16312349-16312371 GCAACCCCCAAAATGATACTTGG - Intronic
1028171158 7:87598592-87598614 GGAAGTTCCAAAATGATAGCTGG + Intronic
1028533543 7:91865120-91865142 GGAAGTTCCATTATGCTACATGG + Intronic
1037201677 8:16261251-16261273 AGAAGCCCCAGAATGCTACAAGG + Intronic
1038976366 8:32701069-32701091 GAAAGTTCCAAAAGGCTTCTAGG - Intronic
1039560840 8:38511199-38511221 GGAAGTCCCAAGATGCTGCTGGG - Exonic
1042361371 8:67886998-67887020 GAAAGTTCCACAAGGCTACTGGG - Intergenic
1043156848 8:76793193-76793215 GGAAACTCTAAAATGTTCCTTGG - Intronic
1050835238 9:10069136-10069158 GGAAGCTGCACAATGCCACAGGG - Intronic
1051683881 9:19636942-19636964 GGAAGCTGGAAAATACTAATTGG + Intronic
1053055416 9:34990687-34990709 GGAAGCTCCGGAAAGCTCCTCGG - Exonic
1055579186 9:77690316-77690338 GGGAGCTACAAAATGAAACTTGG + Intergenic
1056957481 9:91093630-91093652 GGAAGAACCACAGTGCTACTGGG + Intergenic
1059629802 9:116109023-116109045 GGGAGCTCTAAAATGATATTTGG - Intergenic
1061589241 9:131588159-131588181 GGAAGCCCCAAAAGGCTCCCTGG + Intronic
1062001452 9:134217934-134217956 TGAAGTTCCAAAATGCCCCTTGG + Intergenic
1062175174 9:135157849-135157871 TTAAGTTCCAAAATGCTAATTGG + Intergenic
1186640476 X:11449902-11449924 TGAAGCTCCACAATGCTGCTGGG + Intronic
1188133382 X:26465863-26465885 GGAAGTCCCAAAATGCCAGTGGG - Intergenic
1194157857 X:90415532-90415554 GGAAACCCCAAGATTCTACTTGG + Intergenic
1196270002 X:113699248-113699270 GGAAGTTCCAAGATGCTATCTGG + Intergenic
1199722360 X:150551030-150551052 GTGAGCTCCAGAATGCTATTGGG - Intergenic
1200504186 Y:3992501-3992523 GGAAACCCCAAGATTCTACTTGG + Intergenic
1200565438 Y:4759643-4759665 AGTAGCTCAAAAAGGCTACTTGG + Intergenic