ID: 1001727770

View in Genome Browser
Species Human (GRCh38)
Location 5:173921496-173921518
Sequence GGAAGCTCCAAAATGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001727770_1001727777 27 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727777 5:173921546-173921568 TGTAGCAGGGTTAAGAATATGGG No data
1001727770_1001727773 13 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727773 5:173921532-173921554 CATCTTTATTCCTTTGTAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 235
1001727770_1001727774 14 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727774 5:173921533-173921555 ATCTTTATTCCTTTGTAGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 270
1001727770_1001727776 26 Left 1001727770 5:173921496-173921518 CCAAGTAGCATTTTGGAGCTTCC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1001727776 5:173921545-173921567 TTGTAGCAGGGTTAAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001727770 Original CRISPR GGAAGCTCCAAAATGCTACT TGG (reversed) Intronic