ID: 1001728008

View in Genome Browser
Species Human (GRCh38)
Location 5:173924086-173924108
Sequence ATGTTTCTACAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 77, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001728008 Original CRISPR ATGTTTCTACAGATGGAGGA AGG (reversed) Intronic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
902663161 1:17919643-17919665 ATCTTTCTTGAGATGGAGAATGG - Intergenic
903604930 1:24568488-24568510 ATCTTCCTAGAGGTGGAGGAGGG + Intronic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905400358 1:37697756-37697778 TTGTTTCTAGAGATGGCAGAAGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907571379 1:55487319-55487341 ATGTTTCTATACCTGGAGGAAGG - Intergenic
909405140 1:75280778-75280800 ATCTTTCTTCACATGGAGGCAGG - Intronic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
910123752 1:83818294-83818316 ATGTTTCCACTCATGGTGGACGG - Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916317952 1:163471266-163471288 ATGTTTCAAAGGATGTAGGAGGG + Intergenic
916899649 1:169207125-169207147 CTGTTTCTACTCATGGTGGAAGG + Intronic
918177861 1:182061065-182061087 ATATGGCTTCAGATGGAGGAGGG - Intronic
918412737 1:184277135-184277157 ATGCTTCCACTCATGGAGGAAGG - Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921538928 1:216388212-216388234 ATGTGTCTTCAGATTGAGAAGGG + Intronic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
923199550 1:231698151-231698173 ATGTGTTGACCGATGGAGGAAGG + Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1063177286 10:3563299-3563321 AGATTTCTCCAGATAGAGGAAGG - Intergenic
1063209311 10:3864435-3864457 ATGTTTCTACACACCAAGGAAGG + Intergenic
1063565734 10:7171258-7171280 ATGTGCCTTCAGATGGAAGAAGG + Intronic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1064735265 10:18375745-18375767 CTGTGTCTACAGTTGAAGGATGG + Intronic
1065763155 10:29002019-29002041 ATGTTGCTACACTTTGAGGATGG + Intergenic
1066338228 10:34502326-34502348 ATAATGCTAGAGATGGAGGAAGG + Intronic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1067776298 10:49167190-49167212 CAGTTTCTACAGCTGAAGGAGGG - Intronic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1078916407 11:15782801-15782823 ATGTGTCTACAGGTCAAGGAAGG + Intergenic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081982994 11:47281606-47281628 AAATTTCTCCAGATTGAGGATGG - Exonic
1085942393 11:81220692-81220714 ATGTTATTACAGCTGGAGGTTGG + Intergenic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1087117169 11:94537831-94537853 AACTCTCTCCAGATGGAGGAAGG - Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088568794 11:111201134-111201156 ATGTATCTTCACATGGAGGAAGG + Intergenic
1089249175 11:117144956-117144978 ATTTTTCAACAAAAGGAGGAGGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1093193034 12:16097044-16097066 ATGTTTCTTCACATGTAGTAAGG + Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094776587 12:33736474-33736496 AAGTTTCTAGAGATGGATGTTGG - Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095554580 12:43485007-43485029 CTGTTCCAAAAGATGGAGGAGGG + Intronic
1096526206 12:52211831-52211853 ATGCTCCTGCAGAGGGAGGAGGG + Intergenic
1097653260 12:62330230-62330252 ATATTTCTATAGATGAAGCAAGG + Intronic
1098300278 12:69047326-69047348 ATTCTTGTAAAGATGGAGGATGG + Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100686762 12:96995029-96995051 ATATCTCTGCAGAGGGAGGAGGG - Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101003845 12:100382573-100382595 ATGTTTCTTCAAATAGAGGGAGG - Intronic
1101033080 12:100678904-100678926 ATGTTTCTAAAGATGAGGGAAGG - Intergenic
1101625206 12:106433842-106433864 ATATTTCTTCTGATGGGGGAAGG + Exonic
1102877966 12:116462400-116462422 ATGTGTCTTCTGATGGTGGAAGG + Intergenic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1106716166 13:32390655-32390677 ATGCTTCAAAAGCTGGAGGAAGG - Intronic
1107721887 13:43258081-43258103 ATGTTTCCACTGCTGGAGGCTGG - Intronic
1109031820 13:57199950-57199972 ATGTGACTACTGATGGAGGATGG + Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1111592767 13:90371208-90371230 ATTTTTGTACAGATGGGTGAGGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112243032 13:97701393-97701415 AGGTTTCTTCAGATTGAGTAAGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1114149791 14:20025156-20025178 ATGTATCTAGAGAGAGAGGAGGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1117761195 14:59030724-59030746 CTGTTTCTACTCATGGTGGAAGG - Intergenic
1117792894 14:59359380-59359402 ATGTTTCTACAATTGAAGAAGGG - Exonic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1120559036 14:85968599-85968621 ATGTTTCTACAGAAAAATGATGG + Intergenic
1121138540 14:91520634-91520656 GTGATTCTCCTGATGGAGGATGG - Intergenic
1121292610 14:92789108-92789130 ATGTTTCCACCGCTGGAGGAGGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1124228292 15:27916580-27916602 ATGTTTCTGCAGATTTAGAAGGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1125780078 15:42257403-42257425 CTGTTTCTACTCATGGTGGAAGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1128094683 15:64944726-64944748 TCGTTTCTACAGATGGGAGAAGG + Exonic
1128194200 15:65736129-65736151 ATGTGTCTACATTTGGAAGATGG + Intronic
1128643636 15:69359104-69359126 ATGTGTCTTCACATGGTGGAAGG + Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1128949954 15:71868291-71868313 ATGTCTCTGAAGATGGAGAAAGG - Intronic
1132692495 16:1187865-1187887 ATGTTTCTACAGAGGGACGGAGG - Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133968008 16:10545782-10545804 ATTTTTCTACAGACTGGGGAGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1135827662 16:25743854-25743876 ATGTTGCTACAGAAGGAGCTAGG - Intronic
1136855770 16:33655993-33656015 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1137249157 16:46730117-46730139 ATGTTCCTTCAGGTGCAGGATGG - Intronic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1137390921 16:48081000-48081022 ATGTGTCCTCACATGGAGGAAGG + Intergenic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1203117355 16_KI270728v1_random:1504474-1504496 ATGTTTATAGGGATAGAGGAAGG - Intergenic
1144311222 17:14015977-14015999 ATGTTTTTAGAGTTGCAGGAAGG - Intergenic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1145404190 17:22571187-22571209 GTGTTTCGATAGATGGAGGGGGG + Intergenic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1149154878 17:53616159-53616181 CTGATTCTACAGAAGTAGGATGG + Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1153160978 18:2204288-2204310 ATGTTACTGCAGCTAGAGGATGG + Intergenic
1153235939 18:2987749-2987771 TCGTTTCTATAGATGGAAGAAGG - Intronic
1155224265 18:23714756-23714778 AGGGTTCTAGAGATGGATGACGG - Intronic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1157049273 18:44141930-44141952 ATGTATCTTCACATGGTGGAAGG - Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159262025 18:66026448-66026470 CTGTTTCTACTCATGGTGGAAGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160752851 19:742794-742816 AACTGTCTACAGATGGAAGAAGG - Intronic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163642966 19:18472271-18472293 ATTTTTCTATGGATGGTGGAAGG + Intronic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1165032775 19:33010253-33010275 ATGTTTCTACAGCTGATGGGTGG - Intronic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
925429479 2:3778668-3778690 CAGTTTCTCCAGATGCAGGATGG - Intronic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
931451548 2:62371175-62371197 CTGGTTCTAAAGATAGAGGAAGG + Intergenic
931981713 2:67700124-67700146 AGGTTTCTACCTATGGAGCAAGG + Intergenic
932702305 2:74000261-74000283 AAGTTTCTACACAAGGAGGGTGG - Intronic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
940083029 2:149826260-149826282 ATGTTTCTACAGGAGGATGAGGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
941893751 2:170609104-170609126 ATGTTTCTTCTGATGTAGGTGGG + Intronic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
942628169 2:177925995-177926017 ATTTTTCTTCAAATGGAGGAAGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944397952 2:199290781-199290803 ATATTTCTGCAGATTGGGGAGGG - Intronic
945690793 2:213032770-213032792 ATCTTTCCACTGGTGGAGGAGGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946045897 2:216820733-216820755 ATGTATCTTCACATGGTGGAAGG - Intergenic
1173018183 20:39245629-39245651 TGGTTTCTACAGATGGATGGAGG + Intergenic
1174896900 20:54459039-54459061 AGGTCTCTACAGAATGAGGAGGG + Intergenic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153677 20:63607168-63607190 ATGTTTCTGGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153700 20:63607268-63607290 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153726 20:63607404-63607426 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153775 20:63607642-63607664 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153797 20:63607745-63607767 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153804 20:63607779-63607801 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153851 20:63608019-63608041 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153858 20:63608053-63608075 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153870 20:63608119-63608141 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153877 20:63608153-63608175 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153909 20:63608324-63608346 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153916 20:63608358-63608380 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153928 20:63608424-63608446 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153934 20:63608458-63608480 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153948 20:63608526-63608548 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153962 20:63608594-63608616 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153982 20:63608696-63608718 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153996 20:63608764-63608786 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154018 20:63608867-63608889 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154064 20:63609105-63609127 ATGTTTCTGGAAATGGAGGTGGG - Intronic
1176154088 20:63609243-63609265 ATGTTTCTGGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154127 20:63609450-63609472 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154133 20:63609484-63609506 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154161 20:63609619-63609641 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176649005 21:9528963-9528985 GTGTTTCGATAGATGGAGGGAGG - Intergenic
1179722002 21:43321429-43321451 CTGTTTCTCCACATAGAGGATGG + Intergenic
1181012042 22:20046984-20047006 AAGCTTCTACTGATGGTGGAAGG + Intronic
1182078207 22:27509578-27509600 GTGTTTCTCCAGGTGGAGAAGGG - Intergenic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950383519 3:12637509-12637531 ATGTTAATAGAGATGGAGGCGGG - Intronic
950492776 3:13316338-13316360 ATTTTTCTAAAGCTGGAGAAAGG - Exonic
950623416 3:14226110-14226132 ATGTTTCTGCAATTGGAGGAGGG - Intergenic
951249648 3:20380132-20380154 AGGTTTCTAGAGATGGAAGGCGG - Intergenic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
957669170 3:83278424-83278446 ATGTTTCCTCACATGGGGGAAGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
960515977 3:118603243-118603265 AAGTTTCCACAGACTGAGGAAGG - Intergenic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
964608546 3:158585361-158585383 ATGCTTCCACTTATGGAGGAAGG - Intronic
965970860 3:174554951-174554973 ATGTTTCTTCACATAGTGGAAGG + Intronic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
967354313 3:188550950-188550972 TTGTTTCTACAGAAGGAGTTTGG + Intronic
967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG + Intergenic
968180426 3:196591243-196591265 AGGTGACTAAAGATGGAGGAGGG + Intergenic
969239538 4:5889459-5889481 ATGTTGCTCCAGAGGGAGGTGGG + Intronic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
971509752 4:27409341-27409363 AAGCTTCTCCAGTTGGAGGATGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972337971 4:38125166-38125188 AAGTTTCTACATATCTAGGATGG - Intronic
974601590 4:64089840-64089862 CTGTTTCTACTCATGGCGGAAGG + Intergenic
974776214 4:66485430-66485452 ATATTTTTACAGATAGAAGAAGG - Intergenic
974844862 4:67340060-67340082 ATGTCCCCACAGATGGAAGAAGG + Intergenic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978901921 4:113961399-113961421 ATGTTACATCAGATGGAGGTTGG + Intronic
978918482 4:114152797-114152819 CTGCTTCTACAGATGAAGTAAGG - Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980265217 4:130506255-130506277 ATGTTTCTTCAGTTGAAGGAAGG - Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
981203925 4:142016318-142016340 ATGTTACTGCTGCTGGAGGATGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
984376856 4:178942364-178942386 ATTTTTCTATGGATGGAGGAAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984732882 4:183084821-183084843 TTGATTCTAGAGATAGAGGAGGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985289049 4:188368375-188368397 ATATTTCTGCAAATGGAAGATGG + Intergenic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
987070221 5:14329434-14329456 ATGTGTCCTCACATGGAGGAAGG - Intronic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
992032834 5:72740488-72740510 AGGGTTCTAGAGATGGATGATGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992286715 5:75242998-75243020 ATGTTTCTTCAGAAGCAGAAAGG + Intergenic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994048273 5:95333230-95333252 TTGGCTCTACAGATGGAGGAAGG + Intergenic
994132404 5:96245692-96245714 TTGGTTCTACACATGCAGGAAGG + Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
995667751 5:114563038-114563060 GTTTTTCTACAAAAGGAGGATGG - Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996283411 5:121759670-121759692 ATGTTTCTACAGGTTGGGAAGGG + Intergenic
997247470 5:132362620-132362642 AGTTCTCTACAGATGGATGATGG + Intergenic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1003989241 6:11469454-11469476 AAGTTTCTACTCATGGTGGAAGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1004969449 6:20892645-20892667 ATGATTCTGTAGATGGAGAAAGG - Intronic
1005307565 6:24528711-24528733 TTTTTTCTTGAGATGGAGGATGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1005855191 6:29855634-29855656 ATTTCTCTACAGATTGTGGAAGG - Intergenic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008522157 6:52372468-52372490 ATGTTTCTAGAGAGGCAGGCTGG + Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1010066038 6:71683670-71683692 ATGATTCTACATCTGGAGAAAGG - Intergenic
1010348517 6:74842035-74842057 ATGTTTCTAAAGAGAAAGGAGGG + Intergenic
1013696692 6:112710744-112710766 AAGTTTCTAGAAATGGAAGAAGG + Intergenic
1013724489 6:113076848-113076870 AGGTATCTACAGAGGGATGAAGG + Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1015191075 6:130472976-130472998 AACTTTCTTCAGCTGGAGGAAGG + Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1022476604 7:30715046-30715068 ATGTTTCTGCAATTTGAGGAGGG + Intronic
1024657479 7:51463924-51463946 ATGTGTCTTCACATGGTGGAAGG + Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1026399383 7:69993814-69993836 TTCTTTCTACAGATAGGGGAAGG + Intronic
1026501764 7:70948697-70948719 AAGTTTCTACTTATGGTGGAAGG - Intergenic
1027236381 7:76300610-76300632 GTGTTTCTAAAGATAGAAGATGG + Intergenic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028094690 7:86745391-86745413 ATGTTTCTAGATTTGGAGGGTGG - Intronic
1028333673 7:89625788-89625810 TTGGTTCTCCAGATGGAGGCTGG - Intergenic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1030765354 7:113402409-113402431 AAGCTTCTTAAGATGGAGGAGGG - Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033167885 7:139057176-139057198 ATGTTTCTAGAGATGGGGAGGGG - Intronic
1033610534 7:142960109-142960131 AAGTTCCTGCAGATGGAGGCTGG - Intronic
1033771120 7:144553475-144553497 ATGTTTCTCTGGATTGAGGATGG - Intronic
1035458874 7:159027118-159027140 AAGTTTGTACCGACGGAGGAAGG + Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1038892637 8:31743842-31743864 ATGTTTCTACAGAAGCTTGAAGG - Intronic
1040575927 8:48651485-48651507 ATGTAACAACAGTTGGAGGAAGG - Intergenic
1040653048 8:49471676-49471698 ATGTTTCTCAAGATAAAGGATGG + Intergenic
1041053974 8:53963697-53963719 TTGTTTATCCAGCTGGAGGATGG - Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044379232 8:91514321-91514343 TTATTCCTACAGATTGAGGAGGG - Intergenic
1044850817 8:96425481-96425503 TGGCTTCTACACATGGAGGAAGG + Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046299906 8:112274492-112274514 ATGTCTCTAGAGATATAGGAAGG + Intronic
1047533764 8:125700457-125700479 ATGTTTCTAGCTGTGGAGGAAGG + Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050284359 9:4085828-4085850 AAGTTTCTACTCATGGCGGAAGG - Intronic
1050731932 9:8718699-8718721 ACGTTTCTGCAGATGTAGGAAGG - Intronic
1051046589 9:12882761-12882783 TAGTTTATACAGATGTAGGAAGG - Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055824610 9:80307992-80308014 AAGTTTCTACAGATGTTAGAGGG + Intergenic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1056587842 9:87939925-87939947 GTGTTTCGATAGATGGAGGGGGG + Intergenic
1056609025 9:88113020-88113042 GTGTTTCGATAGATGGAGGGGGG - Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1056945062 9:90987683-90987705 CTGTTTCTGCAGGTAGAGGAGGG - Intergenic
1059313278 9:113403008-113403030 ATGTTTCAAAAGGTGGAGGCTGG - Intergenic
1059431703 9:114254429-114254451 CTGTTTCTGCCAATGGAGGATGG + Intronic
1060352501 9:122871112-122871134 ATGTGGCTACAGGTGCAGGAAGG - Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060923138 9:127436753-127436775 ATGTTTCTAAAGATGCAGCCTGG + Intronic
1061648035 9:132022188-132022210 ATGTTTCTACTGGGGGAAGAAGG + Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1203626741 Un_KI270750v1:32512-32534 GTGTTTCGATAGATGGAGGGAGG - Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1188050471 X:25479085-25479107 ATGTGACTACATTTGGAGGAAGG - Intergenic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1189232453 X:39463165-39463187 GTGTTTCTAAGGCTGGAGGACGG + Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1191025641 X:55909951-55909973 ATGTTTCTGCACAGGGAGGGTGG + Intergenic
1193334025 X:80266161-80266183 ATGTGTCTGCAGATGTGGGATGG - Intergenic
1194783955 X:98058674-98058696 ATGTTGCCACTGCTGGAGGATGG + Intergenic
1194827747 X:98583437-98583459 ATGTGTCTCCACATGGCGGAAGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1196396372 X:115266622-115266644 ATGTTTCTAAAGATGTAGAATGG - Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197714606 X:129697412-129697434 AACTTTCAACTGATGGAGGAGGG - Intergenic
1197948023 X:131861799-131861821 GTGTGTCTACCGATGAAGGAGGG - Intergenic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1200413678 Y:2886590-2886612 ATGTTTCTGCAATTGGAGAAGGG + Intronic
1200803243 Y:7405901-7405923 ATGCATCTAGAGATGGATGAAGG + Intergenic
1200871844 Y:8109931-8109953 ATGTTTCTTCACATGGTGGCAGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic
1201939628 Y:19445982-19446004 ATGTTTCTACACAGGGAGATGGG - Intergenic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic