ID: 1001732279

View in Genome Browser
Species Human (GRCh38)
Location 5:173969270-173969292
Sequence GTCAAGAAGGGGAAATAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001732279_1001732291 15 Left 1001732279 5:173969270-173969292 CCCTTCTATTTCCCCTTCTTGAC No data
Right 1001732291 5:173969308-173969330 CTCTGCCTGGGCCACCGTTCTGG No data
1001732279_1001732288 3 Left 1001732279 5:173969270-173969292 CCCTTCTATTTCCCCTTCTTGAC No data
Right 1001732288 5:173969296-173969318 GGGCTGCCGCCGCTCTGCCTGGG No data
1001732279_1001732293 24 Left 1001732279 5:173969270-173969292 CCCTTCTATTTCCCCTTCTTGAC No data
Right 1001732293 5:173969317-173969339 GGCCACCGTTCTGGTAATGCAGG No data
1001732279_1001732287 2 Left 1001732279 5:173969270-173969292 CCCTTCTATTTCCCCTTCTTGAC No data
Right 1001732287 5:173969295-173969317 CGGGCTGCCGCCGCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001732279 Original CRISPR GTCAAGAAGGGGAAATAGAA GGG (reversed) Intergenic
No off target data available for this crispr