ID: 1001732970

View in Genome Browser
Species Human (GRCh38)
Location 5:173973720-173973742
Sequence CTCCATGTACATACCGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001732967_1001732970 11 Left 1001732967 5:173973686-173973708 CCTGTCTCCTAGGTCGTAAGGAT No data
Right 1001732970 5:173973720-173973742 CTCCATGTACATACCGAGCACGG No data
1001732969_1001732970 4 Left 1001732969 5:173973693-173973715 CCTAGGTCGTAAGGATGGAATAA No data
Right 1001732970 5:173973720-173973742 CTCCATGTACATACCGAGCACGG No data
1001732964_1001732970 30 Left 1001732964 5:173973667-173973689 CCTCACAGAATTGGCAGTTCCTG No data
Right 1001732970 5:173973720-173973742 CTCCATGTACATACCGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001732970 Original CRISPR CTCCATGTACATACCGAGCA CGG Intergenic
No off target data available for this crispr