ID: 1001734113

View in Genome Browser
Species Human (GRCh38)
Location 5:173984802-173984824
Sequence CTGTATGAGCAGTATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4782
Summary {0: 1, 1: 0, 2: 53, 3: 944, 4: 3784}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001734113_1001734114 -7 Left 1001734113 5:173984802-173984824 CCATTCTCATACTGCTCATACAG 0: 1
1: 0
2: 53
3: 944
4: 3784
Right 1001734114 5:173984818-173984840 CATACAGATATATCCAAGACTGG 0: 1
1: 0
2: 27
3: 559
4: 3762
1001734113_1001734117 14 Left 1001734113 5:173984802-173984824 CCATTCTCATACTGCTCATACAG 0: 1
1: 0
2: 53
3: 944
4: 3784
Right 1001734117 5:173984839-173984861 GGGTAATTTATAAAAGAAAGAGG 0: 235
1: 3991
2: 10443
3: 10552
4: 7015
1001734113_1001734115 -6 Left 1001734113 5:173984802-173984824 CCATTCTCATACTGCTCATACAG 0: 1
1: 0
2: 53
3: 944
4: 3784
Right 1001734115 5:173984819-173984841 ATACAGATATATCCAAGACTGGG 0: 1
1: 18
2: 452
3: 3381
4: 6240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001734113 Original CRISPR CTGTATGAGCAGTATGAGAA TGG (reversed) Intronic
Too many off-targets to display for this crispr