ID: 1001734650

View in Genome Browser
Species Human (GRCh38)
Location 5:173988770-173988792
Sequence TCCCTCCAGCCCCCCAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001734647_1001734650 -6 Left 1001734647 5:173988753-173988775 CCTCAAGCCCAGCTTTCTCCCTC 0: 1
1: 1
2: 5
3: 57
4: 502
Right 1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG No data
1001734644_1001734650 19 Left 1001734644 5:173988728-173988750 CCACGCAGTGACCGGCTGCCTCG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG No data
1001734641_1001734650 27 Left 1001734641 5:173988720-173988742 CCTGCAGCCCACGCAGTGACCGG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG No data
1001734645_1001734650 8 Left 1001734645 5:173988739-173988761 CCGGCTGCCTCGCTCCTCAAGCC 0: 1
1: 0
2: 0
3: 16
4: 257
Right 1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG No data
1001734643_1001734650 20 Left 1001734643 5:173988727-173988749 CCCACGCAGTGACCGGCTGCCTC 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG No data
1001734646_1001734650 1 Left 1001734646 5:173988746-173988768 CCTCGCTCCTCAAGCCCAGCTTT 0: 1
1: 0
2: 0
3: 22
4: 190
Right 1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001734650 Original CRISPR TCCCTCCAGCCCCCCAGCAG TGG Intronic
No off target data available for this crispr