ID: 1001735887

View in Genome Browser
Species Human (GRCh38)
Location 5:174000765-174000787
Sequence TTTAAGAAGGAGAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 1, 2: 5, 3: 49, 4: 661}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001735887 Original CRISPR TTTAAGAAGGAGAATGAGGT GGG Intronic
900347126 1:2215207-2215229 CTTAAGCAGGAGAACGGGGTGGG + Intergenic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
903007689 1:20309443-20309465 TTTAAAAATGAGCATGGGGTGGG + Intronic
903065127 1:20695483-20695505 TTTAAAAGTGAGAATGGGGTTGG - Intronic
903090965 1:20916659-20916681 TTGAAAAAGAAGAATGAAGTTGG + Intronic
903515270 1:23906223-23906245 TTTAATAAGGGGCAGGAGGTGGG - Intronic
903619847 1:24690064-24690086 TTTAAGAATTAGAATCAGGCCGG - Intergenic
904050342 1:27634745-27634767 TTTAGGAAGGGGGCTGAGGTGGG - Intronic
904787346 1:32992837-32992859 TTTCTGATGGTGAATGAGGTTGG - Intergenic
904867680 1:33594328-33594350 TTTAAGGAGGAGAAAAAGTTAGG - Intronic
905286105 1:36881418-36881440 TTTATGGAGGTGAAGGAGGTTGG - Intronic
905779844 1:40698862-40698884 TTTAATAAGAGGAATGAGATGGG + Intronic
906192854 1:43909381-43909403 TTTATCAAGGAGAATGATCTTGG - Intronic
906442903 1:45865652-45865674 TTTAAGAAGGAAAAGATGGTAGG - Intronic
906456712 1:46003578-46003600 TCTACTTAGGAGAATGAGGTGGG - Intronic
907484129 1:54765323-54765345 TTAGAGAAGGAGAATGGAGTGGG + Intergenic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
909013658 1:70360679-70360701 TTTCATAATGGGAATGAGGTGGG + Intronic
909334779 1:74459465-74459487 GTTACGAAGGAAAAAGAGGTAGG + Intronic
910449331 1:87330264-87330286 TTTTAAAAGGAGAGTGAGGGAGG - Intronic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910665293 1:89719276-89719298 TTAAAGAGGAAGAATAAGGTGGG - Exonic
911354361 1:96797913-96797935 TTTAAGAATTAGAATTAGCTGGG + Intronic
911441835 1:97936748-97936770 TTTAAGAAAGAAATTGAGGAGGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912032488 1:105265877-105265899 GTTAGAAAGGAGAAGGAGGTGGG - Intergenic
912164867 1:107031063-107031085 TTTAAGAATGAGGATGAGGGAGG - Intergenic
912181149 1:107220467-107220489 TTTAAAATGGTGAAAGAGGTAGG - Intronic
912725038 1:112051308-112051330 TTTAAGAAGGCGGATAAGGCTGG + Intergenic
912797110 1:112699992-112700014 ACTAAGAGGGAGAATGGGGTGGG - Intronic
915305932 1:154978389-154978411 TTTTCGATGGAGAATGAGGCAGG - Intronic
915323715 1:155070012-155070034 TATAAGGAGGAGGAGGAGGTGGG + Intergenic
915415294 1:155737338-155737360 TTCAATAAGGAGAATGTGGCAGG - Intronic
915930872 1:160060185-160060207 CTTAAGAAGGAGGATGGGGTAGG + Intronic
916571811 1:166034498-166034520 TTTAACAAGGAGAATTAGGTTGG - Intergenic
916967060 1:169958386-169958408 TTTAAGAAATAAAAAGAGGTCGG - Intronic
917016626 1:170539078-170539100 TTCAAGATAGAGAATGGGGTAGG + Intronic
917195370 1:172458746-172458768 TTTAAAAAGAAGAACGAAGTTGG + Intronic
918727606 1:187945960-187945982 GATAAGAAGGAAAATGATGTAGG + Intergenic
919101362 1:193100886-193100908 TCTAAGTTGGATAATGAGGTTGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
920253065 1:204635359-204635381 TTTAAGGATGAGAACAAGGTTGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920363317 1:205434476-205434498 TTTAAGAAAGAGAAAGAGCCAGG - Intronic
921223893 1:212997634-212997656 TTTAAGAAAGAGAATCAAGGGGG + Intronic
921436201 1:215125888-215125910 TTTAAGAAAGAGAAGGAAATGGG + Intronic
921595447 1:217049297-217049319 TCCAAGAAGGAGAATGAAGCCGG + Intronic
921604686 1:217139197-217139219 TATAGGCAGGAGAATGAGGCGGG + Intergenic
922114128 1:222593680-222593702 TTTAAGAAATAGAATCAGCTGGG + Intergenic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
923082135 1:230668167-230668189 TTTAGCAAGGAGAGTGAGGCAGG + Intronic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923629004 1:235637354-235637376 TTAAAGAATTAGAATGAGGCTGG + Intronic
924127234 1:240867702-240867724 TTTAAGAAAGAAAATCAGGCTGG + Intronic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
924214270 1:241804357-241804379 TTGAAGAAGAAGAATAAAGTTGG + Intergenic
924320248 1:242841421-242841443 CTTAAGTTGGAGAATGAGTTGGG - Intergenic
924506219 1:244687233-244687255 TTTAATAAGGAGAATGAAAAGGG - Intronic
924683373 1:246260725-246260747 TTCAAGAAGGAAAATGGGGCTGG - Intronic
1063707198 10:8441924-8441946 TTTAGTAAGGAGAGTGAGATGGG - Intergenic
1063898814 10:10710804-10710826 TTTAAAAAAGAAAATGAGGAGGG - Intergenic
1064213616 10:13381529-13381551 TTCAAGAAGGAAAAGGAGGCTGG + Intergenic
1064577938 10:16764747-16764769 TTTCAGATGGACAATGAGGGGGG + Intronic
1065536624 10:26721384-26721406 TTTAATAAGGAGAATTAAATAGG - Intronic
1065813579 10:29464493-29464515 TTTGAGGAGGAGAAAAAGGTAGG - Intronic
1065821286 10:29528023-29528045 TTTAAAAAGTAGATTGAGGCCGG - Intronic
1065861901 10:29878859-29878881 TTTAAGCAGAGGAATGAGATCGG + Intergenic
1066546655 10:36507466-36507488 TTGCAGAGGAAGAATGAGGTTGG - Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1067520404 10:46996916-46996938 TTGAAAAAGGAGAATAACGTGGG - Intronic
1069704509 10:70449702-70449724 TTGAAGAAGGACAATGAGATGGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070190862 10:74110916-74110938 TTTAAGAATGAGAATCATGATGG - Intronic
1070731242 10:78829967-78829989 GTTAAGAAGGATTCTGAGGTGGG - Intergenic
1070838337 10:79465682-79465704 TTTGAGACTGAGTATGAGGTTGG - Intergenic
1071425572 10:85545748-85545770 TTTCAGAAGGAGACTGAAGTTGG - Intergenic
1071747227 10:88436001-88436023 ATTAGGAGGGAGATTGAGGTGGG + Intronic
1071769364 10:88707928-88707950 TTTATGAAGGATGCTGAGGTAGG + Intergenic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072300102 10:94052352-94052374 TCTAAGAAGGAGAAGTAGGGAGG - Intronic
1072504814 10:96054982-96055004 CTTCAGAAGGAGAATGACCTAGG - Intronic
1072603892 10:96961024-96961046 GTTAGGAAGGAGATTGGGGTGGG + Intronic
1073142763 10:101260029-101260051 TGAAAGAGGGAGAATGAGGACGG + Intergenic
1073308730 10:102524149-102524171 TTTAAAAAGAAGAATTAGGCAGG - Intronic
1073375912 10:103034391-103034413 TTTAAGGAGAGGAATGAGGTCGG - Intronic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1074454291 10:113583852-113583874 TTGAGGAAGGAGAGAGAGGTGGG - Intronic
1074959153 10:118423705-118423727 TTCATTAAGGAAAATGAGGTTGG - Intergenic
1075198623 10:120382782-120382804 TGTTAGAAGGTGAATGAGGTGGG - Intergenic
1075317221 10:121462555-121462577 TTTAAGCAAGAGAATGGGATGGG + Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1076216096 10:128694627-128694649 TGTGTGAAGGAGAATGAGCTGGG - Intergenic
1077260013 11:1612304-1612326 TTTAAAAAGAAGAATGAAGTTGG - Intergenic
1077963645 11:7103036-7103058 TTTAAGAATGGAAATGTGGTTGG + Intergenic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078385830 11:10891713-10891735 TTGAAGAAGGAGAAGAAGATGGG + Intergenic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1079137577 11:17784655-17784677 TTTAAGCAGGAGAGTGAGGTTGG - Intergenic
1079872139 11:25811787-25811809 TTTGAGAATGAGACAGAGGTTGG - Intergenic
1080338810 11:31232577-31232599 TTTGAAAAGGAGATTGAGATAGG - Intronic
1080941185 11:36920462-36920484 TGTAAGAAGCTGAATGATGTGGG - Intergenic
1081004765 11:37721916-37721938 TTGAAAAAGGAAAATGAGATTGG - Intergenic
1081480856 11:43487500-43487522 TTTAACAAGGAGAAACAAGTTGG + Intronic
1081538477 11:44013095-44013117 TGAAGGAAAGAGAATGAGGTAGG + Intergenic
1084311806 11:68321325-68321347 TTTGAAAAGGACAATGAGGTGGG - Intronic
1085392494 11:76189623-76189645 TTTAAGATTGATGATGAGGTTGG - Intronic
1085621293 11:78039653-78039675 GTTAATCAGGAGACTGAGGTGGG + Intronic
1085846323 11:80069988-80070010 TTTAAAAAGGAAAACGAGGGGGG - Intergenic
1085877055 11:80421103-80421125 TTAAAGAGAGAGAAAGAGGTTGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1086993727 11:93333096-93333118 TGTAAGAAGGAGTATGCAGTGGG - Intronic
1087250684 11:95895915-95895937 TTTAAGAAGGGGAATGACATGGG - Intronic
1087356041 11:97095650-97095672 TTTCAGTAGGAAATTGAGGTAGG - Intergenic
1087921855 11:103875932-103875954 TTTAAGAAGTAGGAGGAAGTGGG + Intergenic
1088258782 11:107925907-107925929 TTTGAAAAGGAGAATGATGGAGG + Intronic
1088371104 11:109089459-109089481 TCAAAGCAGGAGACTGAGGTAGG + Intergenic
1088412106 11:109545523-109545545 TTTAAAAAGAAGAATAAAGTGGG + Intergenic
1088574182 11:111253690-111253712 TTTAAGAAAGACAGTGATGTTGG - Intergenic
1088591716 11:111409055-111409077 TTTCAGAAGGAGGAAGAGATGGG + Intronic
1088763479 11:112954074-112954096 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1088924578 11:114287683-114287705 TTAAAGAAGAAAAATAAGGTGGG - Intronic
1089082270 11:115786708-115786730 CTTAAGAAGCAAAATGAGCTTGG + Intergenic
1089275060 11:117329206-117329228 TCTACTAAGGAGACTGAGGTGGG - Intronic
1089476576 11:118768254-118768276 TTCAAGTAAGGGAATGAGGTAGG + Exonic
1089644669 11:119870891-119870913 TCTAAGAAGGAGAATAAAGAAGG + Intergenic
1090230497 11:125099606-125099628 TTTAAGGGGGAGAGTGATGTGGG - Intronic
1090856851 11:130617190-130617212 ATCAAGTAGGAGAATGATGTAGG - Intergenic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1090920112 11:131199370-131199392 TTGAAGCAGGATAATGAGGCTGG - Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092667187 12:10815704-10815726 TTTAAAAAGGAGAACAAAGTTGG + Intergenic
1093509186 12:19905722-19905744 ATTAAGAAAGAGTATGAGCTGGG + Intergenic
1093582868 12:20804270-20804292 TTTACACAGGGGAATGAGGTTGG + Intergenic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1093975704 12:25419540-25419562 TTTAACAAGGACAATTAGTTAGG - Intronic
1094280205 12:28728705-28728727 TTTAAGTAGGAGAAGTAGATAGG + Intergenic
1094532253 12:31287728-31287750 TGTAACAAGGAGATTGAGCTGGG + Exonic
1095285032 12:40400716-40400738 TTTATGTTGTAGAATGAGGTAGG - Intronic
1095328219 12:40924046-40924068 TTTGAGAAGGAGCAAGAGATTGG + Intronic
1095472152 12:42548822-42548844 TTTAAGAAGAAGGGTGAGGCCGG + Intronic
1095724960 12:45441582-45441604 TATATATAGGAGAATGAGGTTGG + Intergenic
1096502175 12:52070663-52070685 TGTGGGAAGGAGAATGGGGTTGG + Intronic
1096664637 12:53155095-53155117 TTTATGTAGGAGGCTGAGGTAGG + Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097236409 12:57543051-57543073 GTTAAGAAGGTGACTGAGGCTGG + Intronic
1097337768 12:58403602-58403624 TTTAACATAGAGAATGAGGTGGG - Intergenic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1098163305 12:67668258-67668280 TTTAAGAAGTGAAGTGAGGTGGG + Intergenic
1099613456 12:84906482-84906504 TTTAAACAGAAGAATGAAGTGGG + Intronic
1099844359 12:88010721-88010743 TATCAGAAGGAGAAAGAGATAGG + Intronic
1100268010 12:92996873-92996895 TTTAAGGTTGAGAATGAGCTAGG + Intergenic
1101813330 12:108126703-108126725 TGTGAAAGGGAGAATGAGGTTGG - Intergenic
1101889522 12:108700263-108700285 TTTTAGGAGGAAAATGAGTTTGG - Intronic
1101955658 12:109210616-109210638 TTTAAGAATTATACTGAGGTCGG + Intronic
1101956413 12:109216179-109216201 TTTAGAAAGGACACTGAGGTGGG - Intronic
1103134366 12:118494822-118494844 TTTAAGAAGGTGGGTGGGGTAGG - Intergenic
1104737896 12:131150434-131150456 TCTATAAAGGTGAATGAGGTTGG - Intergenic
1105249813 13:18688310-18688332 TCTAACATGGGGAATGAGGTAGG + Intergenic
1106143561 13:27032336-27032358 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1106239076 13:27894498-27894520 TTTAAGAAAGTGAATGAGAGTGG - Intergenic
1106487434 13:30184836-30184858 TTAAAGAGGCAGAATGAAGTAGG - Intergenic
1106578389 13:30997206-30997228 AGTTAGAAGGAGCATGAGGTTGG + Intergenic
1106704006 13:32261196-32261218 TTTCAGAAGGAGAAAAAAGTAGG - Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107078511 13:36348915-36348937 TTGAAAAAGAAGAATGAAGTTGG + Intronic
1107797452 13:44067264-44067286 GTTAAGAGGGAGACTGAGGCCGG + Intergenic
1108013453 13:46048021-46048043 TTTTTGAAGGAGACTGAGCTGGG - Intronic
1108023598 13:46155110-46155132 TTTAGGTGGGAGAATGAAGTGGG - Intronic
1108819762 13:54334395-54334417 TTTAAGAAAGATAGTGGGGTGGG + Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110426046 13:75368740-75368762 TTTGATAAAGAGAATGAGGCCGG + Intronic
1110660260 13:78052563-78052585 TTTAAAAAGTAGAATGAGGGAGG - Intergenic
1111295749 13:86275945-86275967 TTCAAGTAAGGGAATGAGGTAGG - Intergenic
1111430755 13:88145866-88145888 TCTCTGAGGGAGAATGAGGTAGG - Intergenic
1111815238 13:93144930-93144952 TTTAAGAAGAAGAATCACGGAGG + Intergenic
1111889650 13:94065855-94065877 GTTAGGAATGAGAATGAGCTAGG + Intronic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1112065302 13:95786339-95786361 TTTAAGAAGGGTAAAGGGGTAGG + Intronic
1112662937 13:101534355-101534377 TTTTAGAAGAAGAAATAGGTAGG + Intronic
1112783146 13:102924042-102924064 CTTGAGAATGAGAATGAGTTTGG - Intergenic
1113302834 13:109041427-109041449 TTTATAAAGAAGAATGAAGTGGG + Intronic
1115057051 14:29141286-29141308 TCTAATAAAGAGAAAGAGGTGGG + Intergenic
1115078894 14:29426353-29426375 TTTAAGAAGGAAAAGAAGGAAGG + Intergenic
1116666563 14:47783517-47783539 TTTATCAAGGAGAATAAGATTGG - Intergenic
1117548261 14:56810309-56810331 TTAAAGAACGAAAATGAGGAAGG + Intronic
1117609314 14:57465848-57465870 TTTAAGAAGCAGAAATCGGTTGG + Intergenic
1118571673 14:67200439-67200461 ATTAAAAAGGGGAATGGGGTGGG - Intronic
1119089620 14:71769426-71769448 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1119873872 14:78040088-78040110 TTGAAAAAGGAGAACGAAGTTGG - Intergenic
1120082540 14:80232050-80232072 CTTAAGAAGGAGAAATGGGTTGG - Intronic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1120736651 14:88060552-88060574 TTTAAGAAGGAAAAAGGGGAGGG - Intergenic
1120984912 14:90326196-90326218 TTTAAGAAAGAGAGGGAGGCCGG + Intronic
1121826872 14:97017363-97017385 GCTGAGCAGGAGAATGAGGTGGG - Intergenic
1121951747 14:98176958-98176980 TTTTAGAAAATGAATGAGGTGGG - Intergenic
1122038496 14:98965239-98965261 TGTGGGAAGGAGAGTGAGGTGGG + Intergenic
1122658134 14:103275743-103275765 TTTAAAAAGAATAATAAGGTGGG - Intergenic
1123145718 14:106128288-106128310 TTTATGAGTGAAAATGAGGTGGG + Intergenic
1123458981 15:20451139-20451161 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1123659081 15:22549279-22549301 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124165592 15:27323014-27323036 TTTAAGATGCAGTATGAGATCGG - Intronic
1124174740 15:27413658-27413680 TTTAAGACGGAGAATGCAGAGGG + Intronic
1124229771 15:27934166-27934188 TTTAAAAAGGAAGATGGGGTTGG + Intronic
1124312945 15:28643771-28643793 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124396003 15:29302360-29302382 TTTAAAAAGTAGAATGATGCTGG + Intronic
1124699525 15:31900791-31900813 TTGAAAAAGGAGAATAAAGTAGG + Intergenic
1125415297 15:39446177-39446199 TGTAAGAAGGTTAAAGAGGTGGG + Intergenic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126144809 15:45464466-45464488 TTTAAGGAGCAGGAGGAGGTTGG + Intergenic
1127706332 15:61550579-61550601 TTTAAGAAAAAGAATGAGGGAGG - Intergenic
1127859909 15:62985278-62985300 TTTGTGAAGGGTAATGAGGTGGG - Intergenic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1128104309 15:65031819-65031841 TATGAGAAGGAGAGTGAGATGGG + Intergenic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128413937 15:67426571-67426593 TTAAATAATGAGTATGAGGTTGG - Intronic
1128595824 15:68948342-68948364 ATTAAGAGGGAGAATCAGGCCGG + Intronic
1128622967 15:69167450-69167472 TTTAAGAAAGAAAAAGAGGAAGG - Intronic
1129907823 15:79201930-79201952 TTTATTCAGGAGATTGAGGTGGG + Intergenic
1130217846 15:81989023-81989045 TTTTAAAAGGATTATGAGGTAGG - Intergenic
1130518969 15:84647789-84647811 GTTAAGAAGGAGACTCAGGCTGG - Intronic
1130714979 15:86324815-86324837 TTTGAGAAGGTGAGTGAAGTGGG + Intronic
1131081713 15:89542097-89542119 GTTAAGAAGGAGATTGGGGTGGG + Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132364456 15:101247083-101247105 TTTATGCAGGAAAAGGAGGTGGG - Intronic
1133468302 16:6049308-6049330 TTTTTAAAGGAGACTGAGGTGGG - Intronic
1135223348 16:20633931-20633953 TTGAAAAAGGAGAATAAAGTTGG + Intronic
1135749288 16:25044141-25044163 TTTTACAAGGAGAATGAGAAAGG + Intergenic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1136053180 16:27667959-27667981 CTTACAAAGGAGAATGAGCTGGG - Intronic
1136703408 16:32164418-32164440 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136764291 16:32763181-32763203 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1136803807 16:33107205-33107227 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136876035 16:33857645-33857667 TTTATGAGTGAAAATGAGGTGGG + Intergenic
1137754299 16:50889290-50889312 TTTAAGAGAGAAAATGAGGCTGG + Intergenic
1137792745 16:51188573-51188595 TATAAGAATGAGCATGAAGTAGG - Intergenic
1137900165 16:52259079-52259101 TTAAAGAAGGAGAATCAGTCGGG - Intergenic
1138195219 16:55046894-55046916 CCTAAGGAGGAGGATGAGGTAGG - Intergenic
1138523522 16:57587625-57587647 GTTACTCAGGAGAATGAGGTAGG - Intronic
1139042140 16:63010752-63010774 TTTAAGTTGGACAATGAGGAGGG - Intergenic
1139289077 16:65840867-65840889 TGTAAGCAGGAGATTGGGGTTGG - Intergenic
1139397448 16:66651557-66651579 CTTATCTAGGAGAATGAGGTAGG - Intronic
1140074125 16:71681186-71681208 TTTAAGTGGAGGAATGAGGTGGG + Intronic
1140127960 16:72133598-72133620 TGTAACAGGGAGACTGAGGTGGG - Intronic
1140265570 16:73417668-73417690 TTTAAAAAGGAAAAAGAGGCTGG + Intergenic
1140663498 16:77209497-77209519 TTTCAGCTGGGGAATGAGGTAGG - Intronic
1141305887 16:82863759-82863781 TTTAAGAAGAAAAATCATGTTGG + Intronic
1203066648 16_KI270728v1_random:1025305-1025327 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1143778413 17:9215164-9215186 ACTATGAAGTAGAATGAGGTGGG - Intronic
1143840796 17:9730222-9730244 CTTAAGAAGGAGAATGGGCTGGG + Intergenic
1143878344 17:10010446-10010468 TTTAAGAAATAGAATCAGGCTGG - Intronic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144361544 17:14499544-14499566 TTTAGGAAGGGGATTGAGTTGGG - Intergenic
1144609465 17:16696985-16697007 TTTAGGAATGAGCATGTGGTAGG - Intronic
1144903305 17:18618563-18618585 TTTAGGAATGAGCATGTGGTAGG + Intergenic
1144927761 17:18827422-18827444 TTTAGGAATGAGCATGTGGTAGG - Intergenic
1145129266 17:20328186-20328208 TTTAGGAATGAGCATGTGGTAGG - Intergenic
1145195396 17:20889448-20889470 TTTAGGAATGAGCATGTGGTAGG + Intronic
1145372701 17:22320412-22320434 TTTAAGAAGGACAAGGAGCCGGG + Intergenic
1147012587 17:37463082-37463104 TGTAATAAGGAGGCTGAGGTGGG - Intronic
1147503967 17:40995635-40995657 TTTAAGAGGGAGCACAAGGTGGG + Intergenic
1149745196 17:59089986-59090008 GTTAGGAAGGAGGTTGAGGTAGG + Intronic
1149841434 17:59968410-59968432 TTCAAGAAGAAGAATGAGATTGG + Intronic
1150426352 17:65080006-65080028 TATAAGAAAAAAAATGAGGTCGG - Intergenic
1150608333 17:66713344-66713366 TTTAGAAAGCACAATGAGGTCGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1153021891 18:636921-636943 TTTAAAAAGGAGAAAGGGGCTGG - Intronic
1153141362 18:1976059-1976081 TTTAAAAACGAGAATGAGTGGGG + Intergenic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1154245475 18:12693260-12693282 TTTAAAAAGGAGAACCTGGTGGG + Intronic
1154254613 18:12771618-12771640 TCTAAGAAGCACACTGAGGTAGG + Intergenic
1154439020 18:14370580-14370602 TCTAACATGGGGAATGAGGTAGG - Intergenic
1154477250 18:14774351-14774373 TTTAAAAAGGTGAAAGAGGAGGG - Intronic
1155320569 18:24614827-24614849 TTGAAGAAGGAACATGAAGTAGG + Intergenic
1155478144 18:26255949-26255971 TGTAACAAGGAGATTGAGCTGGG + Intronic
1155747640 18:29379942-29379964 TTTAAGAATGAAAATTAGGCCGG + Intergenic
1155943311 18:31821506-31821528 TTTACAAAGGAGACTGAGGTAGG + Intergenic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1156424035 18:36989225-36989247 TTTGAGAATAAAAATGAGGTTGG + Intronic
1156656070 18:39288331-39288353 TTTAAAAAGGAGAATATTGTTGG - Intergenic
1156919072 18:42497317-42497339 TTAAAGAGAGAGATTGAGGTTGG - Intergenic
1157057658 18:44249734-44249756 CTTAAATAGGAGACTGAGGTCGG + Intergenic
1158123834 18:54080453-54080475 TTTAAGAGGCAGAATAGGGTTGG + Intergenic
1158290993 18:55942695-55942717 TTTAAAAAGAAGAATAAAGTTGG - Intergenic
1158862807 18:61609499-61609521 ATTAAAAAGGAGCATGAGGTAGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1159824203 18:73186436-73186458 TTTAAGAAGCAGATTGAAATTGG - Intronic
1160354091 18:78211927-78211949 TCGAAAAAGGAGAATAAGGTTGG - Intergenic
1160610828 18:80083779-80083801 TTTAAGAAAAAGAATGTGATCGG - Intronic
1161483829 19:4524237-4524259 TTTATGAAGGAGACTGAGTCAGG - Intronic
1161985268 19:7649953-7649975 TTTACTCAGGAGACTGAGGTGGG + Intergenic
1162273713 19:9636795-9636817 TTTAAGTTGGAGACTGAGCTTGG + Intronic
1162911859 19:13851841-13851863 TTTAAGAAGGATAGAAAGGTGGG - Intergenic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1163683071 19:18694843-18694865 GTTAGCAAGGAGAGTGAGGTTGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1165532422 19:36415115-36415137 TTGAAAAAGGAAAAAGAGGTTGG - Intronic
1165822519 19:38685585-38685607 TTTCAGAAGCAGAGTGAGTTTGG - Intronic
1166397193 19:42450095-42450117 TTTAAGTTGGAGACTGAGCTTGG + Intergenic
1167062983 19:47162692-47162714 TTTAAGAAGTAAAATAAGGCTGG + Intronic
1167230222 19:48278230-48278252 TTTAAGAAGGTGAATTGGGCCGG - Intronic
1168268107 19:55233908-55233930 TTTAAAAAGAAGAACAAGGTTGG + Intronic
925356498 2:3245507-3245529 TTTAAAATGGGGAATGAGGCTGG - Intronic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
925962666 2:9033290-9033312 TTTCAAGAGGAGAAGGAGGTAGG - Intergenic
926477542 2:13344664-13344686 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
926623864 2:15073180-15073202 TTTAAGAAGTAAAATAAGGATGG + Intergenic
926657129 2:15420312-15420334 ATTAAGAGGTAGACTGAGGTGGG + Intronic
928179645 2:29059257-29059279 GTTAATCAGGAGACTGAGGTGGG + Exonic
928461091 2:31473340-31473362 TTTGAGAAAGAGAATGAAGGAGG + Intergenic
929141731 2:38672427-38672449 TTTCAGAAAGAGAAGAAGGTGGG + Intronic
929309045 2:40400665-40400687 CTTCAGAGGGAAAATGAGGTGGG + Intronic
929378917 2:41325866-41325888 TTTAAAAAGAAGAATCAAGTTGG + Intergenic
930279933 2:49358085-49358107 ATTAAGAACAATAATGAGGTAGG + Intergenic
931156862 2:59643553-59643575 TATAAGAAAGAGAATGATATTGG - Intergenic
931195264 2:60046972-60046994 ATAAAGAAGGAGTATTAGGTGGG + Intergenic
931378212 2:61727231-61727253 TTTAAAAATGGGAATGAGGCCGG + Intergenic
932018037 2:68053109-68053131 TTTTAGAAGGAGTATGTGGAAGG - Intronic
932178975 2:69628346-69628368 TTTGGGAGGGAGAATGAGATTGG - Intronic
935519282 2:104084007-104084029 TTTAAAAATAAGAATGAAGTTGG - Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
937268258 2:120630805-120630827 TTTGTGAAGGAGACTGAGGGTGG - Intergenic
938215811 2:129513139-129513161 CTAAAGAAGGAAAATGAAGTTGG - Intergenic
938545189 2:132322496-132322518 TTTAAGAAGGATAAAAAGATAGG + Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939655834 2:144823796-144823818 TTTAAAAAGGAGAACAAAGTTGG + Intergenic
940357766 2:152764246-152764268 TTTAAGAAGGACAAAAAGATGGG + Intergenic
940364117 2:152827211-152827233 TTGAAGAAAGAAAATGAAGTAGG + Intergenic
940577673 2:155532150-155532172 TTAAAGAATGAAAATGAGATAGG + Intergenic
940831553 2:158472311-158472333 TTTAAAAAGTAGAATTAGGCCGG + Intronic
941037283 2:160582162-160582184 TTTAAGAAGGGGAGTGGAGTGGG + Intergenic
941225380 2:162840384-162840406 TTTAGGAAGGTGAATCAGGTGGG + Intergenic
941331660 2:164185183-164185205 TTTAATAGGGAGTATGAAGTGGG + Intergenic
941706874 2:168668224-168668246 GTTAGGAAAGAGAATGAGTTTGG - Intronic
941759906 2:169230889-169230911 TTTAAGAAGGAGAATTGTGTTGG - Intronic
942623053 2:177868814-177868836 TTTAGGAAGGAATATGAGTTTGG - Intronic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943577909 2:189653047-189653069 TTGAAGCAGGAGAATCAGGCAGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944744270 2:202639531-202639553 TTTAATAAGTAAAATGAAGTTGG - Intronic
945147792 2:206756831-206756853 TTTAGAAAGGACAATGAGATGGG - Intronic
945326878 2:208492416-208492438 TTTTAAAGGGAGAATGAGGGAGG + Intronic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945568398 2:211433283-211433305 TTTAAAAAGGGGAGTGAGGCCGG + Intronic
945673366 2:212828928-212828950 TTTAAGATGTAGTATGAGGCTGG + Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
947804526 2:232956469-232956491 TTTAAGAACCAGAATTAGGCTGG + Intronic
948062857 2:235054329-235054351 TGTAAGAAGGTGAATCACGTGGG + Exonic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
1168835530 20:874822-874844 TTTACTCAGGAGACTGAGGTGGG - Intronic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169076265 20:2761420-2761442 TTTAAGGAGGTGATTAAGGTTGG + Intergenic
1169469207 20:5869134-5869156 TTTAAGCAAGAGAATAAGATAGG + Intergenic
1169620374 20:7499855-7499877 TTTAAGAAGGGGGATTGGGTGGG + Intergenic
1169878473 20:10322668-10322690 TTTAACAAGGAGATTGACCTAGG + Intergenic
1170121664 20:12919088-12919110 TTTGAGAAGGGGAGTTAGGTGGG + Intergenic
1170164210 20:13345079-13345101 TTTAAGAGGCAGAATCAGGCAGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171874042 20:30555279-30555301 TTTAAGAAGGATAAAAAGATAGG + Intergenic
1172260473 20:33560037-33560059 TTTAAAAAGGAAAACAAGGTGGG - Intronic
1172354670 20:34271236-34271258 TCTGAAAAGGAGAAGGAGGTGGG - Intergenic
1172711333 20:36926686-36926708 TTTGAGAAGTAAAATTAGGTTGG - Intronic
1173075596 20:39816182-39816204 TTTAAGTAGAAGTATGAGGTAGG + Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1174421686 20:50403260-50403282 TTTAAAAAAAAGAAAGAGGTTGG + Intergenic
1174980475 20:55388719-55388741 TTTATAAAGGAGAATCAGGACGG - Intergenic
1175455958 20:59114146-59114168 TTTAAGAATGAGAAAGTGCTGGG + Intergenic
1175459502 20:59141657-59141679 TTTGAAAAGGAGAATAAAGTTGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176031125 20:63012574-63012596 TTTAAGAAGGAAAAACAGGATGG - Intergenic
1176259152 20:64170099-64170121 TTTGGGACGGAGAATAAGGTTGG - Intronic
1176456664 21:6918849-6918871 TCTAACATGGGGAATGAGGTAGG + Intergenic
1176834836 21:13783908-13783930 TCTAACATGGGGAATGAGGTAGG + Intergenic
1177252357 21:18611151-18611173 CTGAAGATGGAGAATGAGCTAGG + Intergenic
1177622438 21:23613554-23613576 ATTAATAAGTATAATGAGGTTGG - Intergenic
1177839862 21:26223500-26223522 TATAAGAAGGATATTGAGGAAGG - Intergenic
1178787197 21:35664604-35664626 TTTAGGCAAGAGAATGAAGTGGG + Intronic
1179440814 21:41392806-41392828 TTTAAAAAGGAAATTGAGGCCGG + Intronic
1179597018 21:42449740-42449762 TTTTGCAAGGAGAATGAGATGGG + Intergenic
1181809756 22:25396233-25396255 TTTGAAAAGGACAGTGAGGTGGG + Intronic
1183068105 22:35377592-35377614 TTGAAGATGGAGGATGAGGCTGG - Intergenic
1183611205 22:38907613-38907635 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1184315140 22:43682096-43682118 GGTAAGAAGGAGAATAAGGGTGG - Intronic
1184386203 22:44176075-44176097 TTTAAGAATGAGATTGTGGGAGG - Intronic
1184805157 22:46790381-46790403 ATTAAGAATACGAATGAGGTGGG - Intronic
949233599 3:1781523-1781545 TGTAAGTTGGAAAATGAGGTTGG + Intergenic
949288225 3:2431422-2431444 TTTATGGAGGAGAATGGGATAGG + Intronic
949545647 3:5069959-5069981 TTTAAACAGTAGATTGAGGTAGG + Intergenic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
950114172 3:10439717-10439739 TTTAAAAAGGAGTATCAGGCCGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950527096 3:13530656-13530678 TTTAAGAAGGGGAGGGATGTGGG - Intergenic
951287496 3:20832682-20832704 TTGAAGAAAGAGAAAGAAGTGGG - Intergenic
952138604 3:30453136-30453158 TTTTAGAAAGAGAATCAGGGTGG - Intergenic
952180505 3:30911736-30911758 TTTAAGAAGTAGAAGGAATTTGG - Intergenic
952297347 3:32073051-32073073 TTTAAGATGGAGGCTGAGCTTGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952998573 3:38908992-38909014 TTAAAGGAGGAAAAGGAGGTAGG - Exonic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953405728 3:42658920-42658942 TTTAAGGAGGAGAAGGAGGGTGG + Exonic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953600771 3:44361954-44361976 TTTTAGAAGCAGCATAAGGTTGG - Intronic
953865012 3:46576367-46576389 TTGAGGCAGGAGAATGAGGCAGG + Intronic
954270103 3:49501265-49501287 TTTAAAATTGAGAATGAGATTGG + Intronic
954598394 3:51847490-51847512 TTTTAAAGGGAGAATGAGGGAGG + Intergenic
955252720 3:57300824-57300846 TTTATGAAGGAGTATGGGGTGGG - Intronic
955701344 3:61685069-61685091 CTTAAGAAAGAGAATGAGAGAGG - Intronic
955988177 3:64597019-64597041 CCTAAGATGGAGATTGAGGTGGG - Intronic
956004868 3:64768115-64768137 TTCCAGAAGGAGAAAGAGATGGG + Intergenic
956068116 3:65418549-65418571 TTTAAGAAGGGGAAGAAGATGGG - Intronic
956184412 3:66548841-66548863 TTTAAAAAGAAGAATCAGCTGGG - Intergenic
957158665 3:76579925-76579947 TCTAAAAAGGGGAATCAGGTTGG - Intronic
957199006 3:77108077-77108099 AGCAAGAAGGAAAATGAGGTAGG - Intronic
957367849 3:79249941-79249963 TTTAAGAAGGAGTGAGTGGTTGG + Intronic
957449803 3:80365119-80365141 TTTTAGAAAGAGACTGAAGTGGG - Intergenic
957587567 3:82152003-82152025 TTTAAGTAAGAAAATGATGTGGG + Intergenic
957922815 3:86768605-86768627 ATTAGGAAGGAGAAAGAAGTTGG + Intergenic
957954443 3:87166303-87166325 TTTAAAAAGAAGAATAAAGTGGG - Intergenic
957986104 3:87574269-87574291 TTTAAGTTGGAGGCTGAGGTTGG - Intergenic
958073535 3:88646544-88646566 TTTCAGAAGATGAAAGAGGTAGG - Intergenic
959148984 3:102585478-102585500 TATAAGATGGACAATGAGTTTGG - Intergenic
959700996 3:109299061-109299083 TTTAAGAAAGAAAAAGAGGCCGG + Intronic
959820486 3:110729653-110729675 TTGAAGTAGGAGAGAGAGGTAGG + Intergenic
960107610 3:113814835-113814857 CTTAAGAAGGAAAATGTGATTGG + Intergenic
960510456 3:118542962-118542984 TTTAAGAAAGAGAATAAAATAGG + Intergenic
960742308 3:120848199-120848221 TTTTAGATGTAGTATGAGGTAGG + Intergenic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
961348542 3:126282163-126282185 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
961743654 3:129049412-129049434 TTTAAGGAGGAGAACAAAGTTGG + Intergenic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
962240880 3:133749858-133749880 TTTTAAAGGGAGAATGAGGGAGG + Intronic
962300879 3:134242003-134242025 TATAAGAATGAGAATGAGGCCGG + Intronic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
964628761 3:158785623-158785645 TTGAAGAAGGAGAACCAAGTGGG + Intronic
964695698 3:159505395-159505417 ATTACGAAGGAGAACAAGGTTGG + Intronic
964884893 3:161470708-161470730 TCTGAGAAGGAGAATCGGGTGGG + Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
966559861 3:181308184-181308206 ATAAGGAAGGAGAATGAGCTAGG + Intergenic
966839911 3:184080091-184080113 GTTAATAATGAGACTGAGGTGGG + Intergenic
966843112 3:184105549-184105571 TTTAGGATGAAGAATGAGGCTGG - Intronic
967105976 3:186255400-186255422 TATAAGAAGGTGACTGAGGCTGG + Intronic
967201842 3:187078937-187078959 CTTGAGAAGGAGCATGAGTTAGG + Intergenic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
968875779 4:3267210-3267232 TTTAAAAAGGTGAAAGAGGCCGG + Intronic
971040805 4:22749957-22749979 TTTAAGAAGGAGAAATTGGCCGG - Intergenic
971437923 4:26647596-26647618 TTTAATAAGTAGAATAAGATGGG - Intronic
971702461 4:29996305-29996327 TTTACTCAGGAGGATGAGGTAGG + Intergenic
972994253 4:44860551-44860573 TATTAGAATGAGAATGAGTTTGG + Intergenic
974435951 4:61857393-61857415 TTTATCAAGGAAAATGAGGTTGG + Intronic
974522235 4:62996588-62996610 TTGAGGAAGGAGAATGACCTTGG - Intergenic
975299061 4:72768048-72768070 TTAAATGAGGAGAATGATGTAGG - Intergenic
975485055 4:74926688-74926710 TTTGGGAAGGAGGGTGAGGTAGG + Intergenic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
976967914 4:91067638-91067660 TTAAAGAAGAAGGATGGGGTGGG - Intronic
977090457 4:92668207-92668229 CTTAAGAATGAGATTGATGTAGG + Intronic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
978493745 4:109336377-109336399 TTTAAAAACAAGAATGAAGTTGG - Intergenic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
979268836 4:118735398-118735420 GTAAAGAATGAGAGTGAGGTGGG + Intronic
979625115 4:122835752-122835774 TTTAAGAAGGAAAGCCAGGTAGG - Intronic
979792997 4:124809651-124809673 TTTAAGGAGGATAAAGACGTGGG + Intergenic
980714877 4:136615740-136615762 TTTAAGTTGGAGGCTGAGGTTGG - Intergenic
980755377 4:137151840-137151862 TTTCAGAAGTTAAATGAGGTTGG - Intergenic
981318315 4:143363526-143363548 TTGAAGAAGGAAAGTGTGGTTGG + Intronic
982126831 4:152190996-152191018 TTTAATATGGAGAATGGGTTAGG + Intergenic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
982410146 4:155066198-155066220 CGTAAGAAGGAGAATGAGCAAGG - Intergenic
982855352 4:160375376-160375398 TCTAAGAAGGATAATGAGGCTGG - Intergenic
983132427 4:164037967-164037989 TTTAAGGAGGAGATGGTGGTGGG + Intronic
983335193 4:166383017-166383039 TTTTAGAACAAGAATGATGTTGG + Intergenic
983443063 4:167812957-167812979 TTTAAGAAAGAAGATGAGGAAGG - Intergenic
983706088 4:170661120-170661142 TTTAAGAGAGAGTAAGAGGTAGG + Intergenic
983976688 4:173943452-173943474 TTTTCAAAGGACAATGAGGTGGG - Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984012785 4:174390504-174390526 TTTAAGAAGGAGAGGTTGGTCGG + Intergenic
984603303 4:181753973-181753995 TTTAGGAAGTAAAATGATGTGGG + Intergenic
984619711 4:181938575-181938597 TATAAAAAGGAGCATTAGGTTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986210402 5:5666320-5666342 TTATAGAAGGTGAATGAGATTGG - Intergenic
987558892 5:19492216-19492238 ATTAAGCCGGAGAATTAGGTTGG + Intronic
988818397 5:34856728-34856750 TTTATAAAGGAGAAGCAGGTTGG + Intronic
988944596 5:36183561-36183583 TTTAAGAAGTAGAATTTGGCTGG - Exonic
988947314 5:36218704-36218726 TGGAGGAAGGAGCATGAGGTTGG - Intronic
989345504 5:40425032-40425054 TTAGAGAAGGAGAAAGAGTTTGG - Intergenic
989713355 5:44428283-44428305 CTTAAGAATGAGAGTGAGCTTGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990722172 5:58708923-58708945 TTTAAGAAGAAAGACGAGGTAGG - Intronic
990736571 5:58869938-58869960 TTGAAGAAGGAGAATGGCATGGG + Intergenic
990867362 5:60395075-60395097 ATTAAGATGGAGCATGAGGAAGG - Intronic
991208873 5:64081897-64081919 TTTAAAAAAGAGAATGAAATTGG - Intergenic
991410639 5:66342088-66342110 TTTAACAAGGAGAAGGGGTTAGG - Intergenic
991509778 5:67364028-67364050 TTTTAGAAGGAGAAGGACTTTGG - Intergenic
991699847 5:69307385-69307407 TTTAAGAAGAAAAATGGGCTGGG + Intronic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
993134045 5:83934525-83934547 TTTAAGAAGGAAAAGGATTTTGG + Intergenic
993722019 5:91330993-91331015 TTTAATGATGAAAATGAGGTGGG + Intergenic
994034366 5:95181523-95181545 TTTATGAAGGAAAATGAAGAGGG - Intronic
994980664 5:106872518-106872540 TTTAAGAGGGAGAATAATGATGG - Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995448335 5:112272052-112272074 TTTCAGAAGGACACTGATGTAGG - Intronic
996063629 5:119058088-119058110 ATTAAGACGGGGAATGAGGCTGG + Intronic
996496651 5:124164698-124164720 TCCAATAAGGAGAATGATGTTGG + Intergenic
996518083 5:124395653-124395675 TTTGAGAAGCAGAGTGAGCTGGG - Intergenic
996822638 5:127647758-127647780 TATAGGAAGGAGGGTGAGGTCGG + Intergenic
997170391 5:131713340-131713362 TTTAAGAAGGGGTACGAGGCCGG - Intronic
997354925 5:133256245-133256267 ATTTAGAAGGAGAATAATGTGGG - Intronic
997404553 5:133634588-133634610 TTTAACAGGAAGAATGGGGTGGG + Intergenic
997551882 5:134760414-134760436 TTTGAGAAGTAGTAGGAGGTAGG + Intronic
998053196 5:139053490-139053512 TTGAAGCAGGAGAATGACATAGG - Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998918157 5:147038911-147038933 TTTAAAAAGTATAATGAAGTAGG + Intronic
998921842 5:147077718-147077740 TTTAAAAAGAAGAATTAGGTTGG - Intronic
999014549 5:148086421-148086443 TTAAAAAAGGAGAAAGAGATGGG + Exonic
999083576 5:148866962-148866984 TTTAAGGAGGTGAATAATGTGGG + Intergenic
1000519936 5:162282920-162282942 TTTAAAAAGGAGATACAGGTGGG - Intergenic
1000742240 5:164983803-164983825 TTCAAGGAAAAGAATGAGGTGGG - Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1003453132 6:6255840-6255862 TTTAAAAAGAAGATTGAGGGTGG + Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1004058049 6:12161173-12161195 TCTCAGAAGGGGAATGAGGCAGG - Intronic
1004174167 6:13324440-13324462 TTTAAGAAAGAAAAGGAGGATGG + Intronic
1004221410 6:13750429-13750451 TTTAAAAAGAAGAATGAAGGTGG - Intergenic
1004443236 6:15673502-15673524 TTAAAGAAGTAGAAAGAAGTGGG + Intergenic
1004450703 6:15742923-15742945 TTTAGGCAGTAGAATGAGGATGG - Intergenic
1004813939 6:19291954-19291976 TTTATGAAAGAGAAGGAGCTGGG - Intergenic
1004986748 6:21091422-21091444 TTTGAAAGGGAGAATGAAGTAGG + Intronic
1006057331 6:31395120-31395142 TTTATGGAGGAGAGTGAGATTGG - Intergenic
1006069750 6:31489768-31489790 TTTATGAAGGAGAGTGAGATTGG - Intergenic
1006350689 6:33518973-33518995 TGTATGAAGGAGAATGAGAGGGG + Intergenic
1006352840 6:33533754-33533776 CCTATGAAGGAGAATGAGGTGGG + Intergenic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008082058 6:47204929-47204951 TGTAGGATGGAGAATGAGGCAGG - Intergenic
1008102916 6:47412034-47412056 TTGAAAAAGGAGAATAAAGTGGG + Intergenic
1008155298 6:48006941-48006963 TTTAAGAAGGTGAACTAGCTGGG + Intronic
1008305885 6:49899586-49899608 GTTAGGAAGAAGAATGTGGTTGG - Intergenic
1008418008 6:51265745-51265767 TTTAAGGAGGATGATGAGGGAGG - Intergenic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1011067337 6:83341667-83341689 TTTAAGACTAAGAATGAGGCAGG + Intronic
1011082743 6:83507715-83507737 TATAAGAAAGAGAAGGAGCTGGG + Intergenic
1011109973 6:83827178-83827200 TTTCAGAATGACAATGGGGTGGG - Intergenic
1012547231 6:100433478-100433500 ATTAAGCAGGACAAAGAGGTAGG - Intronic
1012574511 6:100776011-100776033 TTAAAGAAGAAGAATAATGTGGG + Intronic
1012805202 6:103884806-103884828 TTTAAGATGAAAAATGAGTTGGG - Intergenic
1013670456 6:112396702-112396724 ATAAGAAAGGAGAATGAGGTTGG - Intergenic
1014383335 6:120771632-120771654 TTTAAATAGGAGAAAGAGGGAGG - Intergenic
1014806617 6:125837522-125837544 TTCAAAAAGGAGAAAGAGTTTGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015371711 6:132461660-132461682 TTAAAGAATGAGAATGATTTTGG - Intronic
1015481578 6:133717010-133717032 TTTAAAAAGAAGAATAAAGTTGG + Intergenic
1016666804 6:146651508-146651530 TTTAAGAAGGAAAACTTGGTAGG + Intronic
1016754411 6:147668137-147668159 TCTGAAAAGGAAAATGAGGTTGG - Intronic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017088133 6:150733808-150733830 TTTAACCAGGATAAGGAGGTAGG + Exonic
1017687056 6:156923989-156924011 TTTAAGAATGAGAATCAGTCTGG - Intronic
1020361928 7:7336038-7336060 TTTAAGCAGCTGAATGTGGTTGG + Intergenic
1020706674 7:11552619-11552641 GTTAAAAAGGAAAATGATGTGGG - Intronic
1021485488 7:21164049-21164071 TTTAAAAAGAAGAATCTGGTAGG - Intergenic
1021619328 7:22536097-22536119 TTAAAGAAGGAGCATGGGATAGG - Intronic
1022270668 7:28804548-28804570 GTTAAGAAGGAGAATAAGAAGGG - Intronic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022920826 7:35012311-35012333 TGAATGAAGCAGAATGAGGTAGG - Intronic
1022999758 7:35796580-35796602 TGTAAAAAGGAGAGTGAAGTGGG + Intergenic
1023128486 7:36978546-36978568 TTCAAGAAGAAGAAAGAGTTGGG + Intronic
1023446035 7:40232572-40232594 ATTAAGAAGAAAAATGGGGTAGG + Intronic
1024426415 7:49231313-49231335 TTTAAATATGAGAATGAGGCTGG + Intergenic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1025975469 7:66366099-66366121 TTTAAGAAGGAGGAAGAAATGGG - Intronic
1026015863 7:66670053-66670075 TTTAAGAAGGAGAATGAGATGGG - Intronic
1026512883 7:71041820-71041842 TTTCAGAATGAGAATGAGTGAGG + Intergenic
1026892491 7:73990432-73990454 TTTAAGCAGGAGAATGAGATGGG - Intergenic
1026923459 7:74173228-74173250 TTTGAGATGGAGAATCAGGTTGG - Intergenic
1028325241 7:89516084-89516106 GTTCAGAAAGAGAAGGAGGTGGG + Intergenic
1028371932 7:90101493-90101515 TTAAAGAAGGAGCATGGGATAGG + Intergenic
1028493424 7:91439286-91439308 TTTAAGATGGAGTAAGAGATTGG - Intergenic
1028638225 7:93015067-93015089 TTTAAGAAGAAGAAACAGATGGG - Intergenic
1028947871 7:96601362-96601384 GTTTAGAAGGAGGATGGGGTGGG + Intronic
1029191756 7:98776972-98776994 TTTAAGAGGGAGACTCAGGTCGG - Intergenic
1030096586 7:105906234-105906256 TATAAAAAGGAGACTGAGGCAGG + Intronic
1030176839 7:106662387-106662409 TTAAATAAGGAGAATGAACTAGG - Intergenic
1030241540 7:107331740-107331762 TTTAAGAAGAAGCAGCAGGTGGG + Intronic
1030773255 7:113500976-113500998 TTTAAGAAGGAAAATTACATTGG - Intergenic
1030838649 7:114320053-114320075 GTTCAGTAGAAGAATGAGGTGGG + Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032301709 7:130693589-130693611 TTAAAGAAAAAGTATGAGGTTGG - Intergenic
1032709803 7:134451653-134451675 TACCAGAATGAGAATGAGGTGGG - Exonic
1033200614 7:139365797-139365819 TATAAGAAGGTGAAGGAAGTTGG + Intronic
1033561495 7:142536351-142536373 TGTAATAGGGAGAAGGAGGTGGG + Intergenic
1034132692 7:148735113-148735135 TTTGAGAATGAGAATGAGATTGG + Intronic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1036511938 8:9408522-9408544 ATTAGGTAGAAGAATGAGGTTGG + Intergenic
1036743207 8:11384997-11385019 TTGAAAAAGAAGAATGAAGTAGG + Intergenic
1037052275 8:14390941-14390963 TTTAAGAAGGAAGAATAGGTTGG + Intronic
1037073179 8:14677852-14677874 TTGAAGGAGGAGAACGAAGTTGG + Intronic
1037245622 8:16831289-16831311 TTTAAAAAGGAGAATCAGCCAGG - Intergenic
1037750805 8:21680970-21680992 TTTAAGTAGGAGGGTGAGGCTGG + Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038293042 8:26267014-26267036 TTTGCGCAGGAGAAGGAGGTGGG + Intergenic
1038562347 8:28591256-28591278 TTTGATAAGGAGAGAGAGGTGGG + Intergenic
1038679678 8:29655197-29655219 TTTCAGCAGAAGAATGAGCTGGG - Intergenic
1038679816 8:29656327-29656349 TTCAAGGAGGAGGATGAGGCAGG - Intergenic
1038795716 8:30707546-30707568 GTTACTAAGGAGACTGAGGTGGG + Intronic
1038888390 8:31691027-31691049 CTTGAGAATGAGACTGAGGTTGG + Intronic
1040106925 8:43546676-43546698 TTTCAGAAGGACATTGAGGCAGG - Intergenic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1040594824 8:48827107-48827129 TTTAAAAAGGAGAGAGAGGTGGG - Intergenic
1041007909 8:53513906-53513928 ATTTAGAAAGAGAATGAGTTAGG + Intergenic
1041120206 8:54578917-54578939 TCTAAGAAGGGGGATGAGGCAGG - Intergenic
1041412620 8:57573545-57573567 TTTAAGAAGAAGAGTGAGTGGGG + Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042069774 8:64918836-64918858 TTGAAGGAGGAGAAAGAGATAGG + Intergenic
1042454401 8:68983814-68983836 TGGAAGAAGGGGAATGAAGTCGG + Intergenic
1043448009 8:80338464-80338486 TATAAGAAAAAGAATGAGTTTGG - Intergenic
1043639715 8:82436492-82436514 TTTGAGAAGGAGCAGGAGCTAGG + Intergenic
1044854862 8:96465516-96465538 TTTCAGAATTAGAATGTGGTTGG + Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045619971 8:103965098-103965120 TTGAAGGAGAAGAATGAAGTTGG - Intronic
1045686662 8:104719827-104719849 TTTAAGTAGAAGAGTGAGGAGGG + Intronic
1045738936 8:105331317-105331339 TTTAAGGAAGAGTATGAGTTTGG + Intronic
1045829348 8:106439643-106439665 AATAAGAAGGTGATTGAGGTGGG - Intronic
1045932801 8:107646881-107646903 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1045977344 8:108144785-108144807 TCTATGAAGTAGAATGAAGTGGG + Intergenic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046318021 8:112532261-112532283 TTAAAGAAGGAGTGAGAGGTAGG + Intronic
1046522695 8:115345816-115345838 TTTAAAAATGAGAAGTAGGTGGG + Intergenic
1046526190 8:115384945-115384967 TTTAAAAGGAAGAAGGAGGTGGG + Intergenic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046889196 8:119402494-119402516 CTCAAGAGGGTGAATGAGGTTGG - Intergenic
1046991243 8:120457832-120457854 TTGAGGCAGGAGAATGAGGCAGG + Intronic
1047210388 8:122835655-122835677 TTTAATGAGGAAAAAGAGGTAGG + Intronic
1047286642 8:123492937-123492959 TTTGAGAAGGAGAACAATGTGGG - Intergenic
1047433994 8:124819314-124819336 TATAAGAGGTAGAATGAGGGAGG - Intergenic
1047748859 8:127865230-127865252 TTTCAGAAGGACAAGGTGGTAGG + Intergenic
1049056430 8:140240834-140240856 TTTAAGAAGGTGAGTGGGGCTGG - Intronic
1050001874 9:1085688-1085710 TTTAAGTGGCAGAAAGAGGTGGG - Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053605640 9:39655815-39655837 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1053863559 9:42412445-42412467 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1053910016 9:42889070-42889092 ATTAAAAAAAAGAATGAGGTAGG + Intergenic
1054247903 9:62686600-62686622 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1054371773 9:64406017-64406039 ATTAAAAAAAAGAATGAGGTAGG + Intronic
1054562017 9:66721125-66721147 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1055715816 9:79116864-79116886 TGTAAGGAGGAGAAGGAGGTAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055757433 9:79571566-79571588 TTAACGAAGAGGAATGAGGTTGG - Intergenic
1055935466 9:81600460-81600482 TTTAAAAAGAAAAATGAGATGGG - Intronic
1057404079 9:94752002-94752024 GTTACTAAGGAGACTGAGGTGGG - Intronic
1057773260 9:97984786-97984808 TTTAAGAAGGGGGAGGGGGTCGG - Intronic
1058398302 9:104582001-104582023 TTACAGAAGGAGAATGACTTTGG - Intergenic
1059011616 9:110467745-110467767 GTTACTCAGGAGAATGAGGTGGG - Intronic
1059111765 9:111564632-111564654 TTCAAGAATAAGAATGAGTTGGG - Intronic
1059227073 9:112682074-112682096 TTTAAGAAGGAAAAAGCGGCCGG - Intergenic
1059279635 9:113121236-113121258 TTCAGGAAGGAGGCTGAGGTGGG + Intergenic
1060146906 9:121260866-121260888 TGTAAGAAGGAGAAAGTGGAAGG + Intronic
1060774494 9:126362832-126362854 TTTAAAAAATAAAATGAGGTGGG - Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1061774148 9:132949413-132949435 CTCAAGAAGGAGAATCAGGCTGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1188169045 X:26899069-26899091 TTTAAGAATAAAAATGAGATTGG - Intergenic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189193544 X:39132738-39132760 TTGAAGATGGAGGAAGAGGTAGG - Intergenic
1189280717 X:39818703-39818725 TTTAAGAAGGATAAAGGGGGGGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1190154459 X:47977073-47977095 TTTCTGATGGACAATGAGGTTGG + Exonic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190738412 X:53270949-53270971 TTTTAGAAGGGAAATGAGGGAGG - Intronic
1191666805 X:63711355-63711377 TTGAAAAAGGAGAATAAAGTTGG + Intronic
1192613845 X:72596802-72596824 TTTAAAAAGAAGACTGAAGTTGG + Intronic
1192919208 X:75687965-75687987 TTTAACAAGAAGAATAAAGTTGG - Intergenic
1192928164 X:75778125-75778147 TTTTAAAGGGAGAATGATGTTGG + Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193561335 X:83021424-83021446 TTTAAAAAGAAGAATGAAGTTGG + Intergenic
1193972552 X:88073865-88073887 GTAAAGAAAGAGAAAGAGGTCGG + Intergenic
1195093978 X:101488722-101488744 GTTAAGATGGAGACTGTGGTTGG + Exonic
1195279701 X:103319317-103319339 TTTAGGAAAGAGGATCAGGTTGG + Intergenic
1195345161 X:103942558-103942580 TTGAGGAATAAGAATGAGGTGGG - Intronic
1195689328 X:107610927-107610949 TTTAGCAAGGAGGATGAGGATGG - Intergenic
1195910986 X:109888067-109888089 TTTACGTAGGAAAAAGAGGTAGG - Intergenic
1196309509 X:114146287-114146309 TTTAAAAAGAAGAATAAAGTGGG + Intergenic
1197324123 X:125070496-125070518 TTTAAGCAGGAGAGTGATCTTGG + Intergenic
1197397277 X:125941957-125941979 TTTAAGGGGGAGGATGAGGGAGG + Intergenic
1198009532 X:132536870-132536892 TTTAAAAAGAAGAACGAAGTTGG - Intergenic
1198073321 X:133170708-133170730 GTTAAGATGGAAAATGAGGTGGG + Intergenic
1198155454 X:133955429-133955451 CTTATGAAGGAAAATGAGGAGGG - Intronic
1198381769 X:136090805-136090827 TTGAAGAAGAACAATAAGGTGGG + Intergenic
1199723647 X:150561474-150561496 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200424151 Y:3003860-3003882 TTTAAGGTGGTGACTGAGGTCGG + Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic