ID: 1001737797

View in Genome Browser
Species Human (GRCh38)
Location 5:174021047-174021069
Sequence AAGGGGAAGCAGAAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001737783_1001737797 29 Left 1001737783 5:174020995-174021017 CCTGAGGCTGAAAAACAGGAGGA No data
Right 1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001737797 Original CRISPR AAGGGGAAGCAGAAGGGGAA AGG Intergenic
No off target data available for this crispr