ID: 1001739798

View in Genome Browser
Species Human (GRCh38)
Location 5:174043286-174043308
Sequence ACTACTGGATGTTCATCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001739798_1001739801 -3 Left 1001739798 5:174043286-174043308 CCTTTAGATGAACATCCAGTAGT No data
Right 1001739801 5:174043306-174043328 AGTGGAATTGCTGTATCATATGG 0: 16
1: 559
2: 2912
3: 7072
4: 10048
1001739798_1001739802 18 Left 1001739798 5:174043286-174043308 CCTTTAGATGAACATCCAGTAGT No data
Right 1001739802 5:174043327-174043349 GGTAGTTCTATTTTTAAATTTGG No data
1001739798_1001739803 21 Left 1001739798 5:174043286-174043308 CCTTTAGATGAACATCCAGTAGT No data
Right 1001739803 5:174043330-174043352 AGTTCTATTTTTAAATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001739798 Original CRISPR ACTACTGGATGTTCATCTAA AGG (reversed) Intergenic
No off target data available for this crispr