ID: 1001743429

View in Genome Browser
Species Human (GRCh38)
Location 5:174071840-174071862
Sequence CTCAAATGGAAGGGGATCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001743422_1001743429 5 Left 1001743422 5:174071812-174071834 CCCGGGTAGACAGGGTCAGGGAA 0: 1
1: 0
2: 1
3: 23
4: 222
Right 1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 116
1001743419_1001743429 9 Left 1001743419 5:174071808-174071830 CCTGCCCGGGTAGACAGGGTCAG 0: 1
1: 0
2: 0
3: 16
4: 186
Right 1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 116
1001743418_1001743429 12 Left 1001743418 5:174071805-174071827 CCACCTGCCCGGGTAGACAGGGT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 116
1001743423_1001743429 4 Left 1001743423 5:174071813-174071835 CCGGGTAGACAGGGTCAGGGAAG 0: 1
1: 0
2: 3
3: 34
4: 283
Right 1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001743429 Original CRISPR CTCAAATGGAAGGGGATCCC CGG Intronic
900230110 1:1552415-1552437 CTAAAATCGAAGGGGGTCCCAGG - Intronic
904585603 1:31578089-31578111 TTTAAATGGAAAAGGATCCCAGG + Intronic
907872413 1:58455119-58455141 TTCAACTGGGAGAGGATCCCAGG + Intronic
912499374 1:110111930-110111952 CTCAATTAGGAGGTGATCCCAGG - Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915512884 1:156396257-156396279 CTCAAATCTGAGGGGAGCCCAGG + Intergenic
916009139 1:160688851-160688873 CTCTAGTGGAAGGGAATTCCTGG - Intronic
919610373 1:199738528-199738550 CTAAGATGGAAGGGCATCCCAGG + Intergenic
922226494 1:223650239-223650261 TGTAAATGGAGGGGGATCCCAGG - Intronic
1063418757 10:5894057-5894079 CTCAGATGTGAGAGGATCCCGGG + Intronic
1065938385 10:30541965-30541987 CTGAAGTGGAAGGGGCTGCCTGG - Intergenic
1066741616 10:38523481-38523503 CTCGAATGGAAGGGGATAGAAGG + Intergenic
1068104696 10:52599705-52599727 CACACATGGAAGGGGGTCCTAGG + Intergenic
1070396527 10:76015625-76015647 CTCAAGTGGAAGGGGTTACAGGG + Intronic
1070606246 10:77900479-77900501 CTCTTATGGAAGGGGGCCCCGGG - Intronic
1072555215 10:96509579-96509601 TTCATGTGGAAGGTGATCCCAGG - Intronic
1074111695 10:110427285-110427307 CACACATGGAGGAGGATCCCAGG + Intergenic
1074128658 10:110553096-110553118 TTTAAATGGGAGGAGATCCCAGG - Intergenic
1076024461 10:127100533-127100555 CTCAGGAGGAAGGGGAGCCCTGG + Intronic
1077275510 11:1705325-1705347 TTCACATGGAAGTGGATCTCTGG - Intergenic
1077395018 11:2316377-2316399 CTCAGATGGAAGGGTGACCCGGG + Intronic
1079338765 11:19595014-19595036 TTTATATGGGAGGGGATCCCAGG + Intronic
1079496525 11:21050944-21050966 TTCCAATGGAAACGGATCCCAGG + Intronic
1080422822 11:32126829-32126851 CTCCCATGGGAGGGGCTCCCAGG - Intergenic
1080738566 11:35041955-35041977 AGCAAATGAAAGGGGAACCCTGG - Intergenic
1080874911 11:36266331-36266353 CTGAACTGGAAGTGTATCCCTGG - Intergenic
1081732694 11:45382710-45382732 TGGAAATGGAAGGGCATCCCAGG + Intergenic
1083697099 11:64450070-64450092 CTCAGGTGGACGGGGATGCCCGG + Exonic
1085681880 11:78583669-78583691 CACAAATGGAAGAGGATTCCAGG - Intergenic
1087397863 11:97625135-97625157 CTTAAATGGAAGGGGATTATGGG + Intergenic
1087958970 11:104324559-104324581 CTCAATGGGGAGGGGATTCCAGG - Intergenic
1090802929 11:130185071-130185093 CTCAAATGCTGGGGGATCCTTGG - Intronic
1092893656 12:12992756-12992778 CTCAAATGAAAGGGGAGTTCTGG - Intronic
1093529224 12:20141009-20141031 GTCACATGGAAGGGGCTCTCTGG + Intergenic
1096916453 12:55038665-55038687 CTCAGAGGGAAGGGGCTACCTGG + Intergenic
1100617292 12:96240762-96240784 CTGAAATGGCAGAGGATCCAGGG + Intronic
1101159171 12:101955951-101955973 CTCAAATGGAACAGAATCCCAGG + Intronic
1101542363 12:105676752-105676774 CTCAAATGGAAAAGGTCCCCTGG - Intergenic
1106347202 13:28890836-28890858 CTCAAATGAAGTGGAATCCCTGG - Intronic
1106407186 13:29484360-29484382 ATCAAATAGAAAGAGATCCCTGG + Intronic
1109256493 13:60089575-60089597 GCCAAATGGAAGAGGATCCATGG - Intronic
1113634913 13:111912825-111912847 CTTAAGTGGAAAGTGATCCCAGG - Intergenic
1120847365 14:89138408-89138430 TTTAATTGGGAGGGGATCCCAGG + Intronic
1121474638 14:94186263-94186285 CTGGAATGGAAGGGGCTCACGGG - Intronic
1122545237 14:102518054-102518076 CTGAACTGGAAGGGGCTTCCTGG + Intergenic
1128317764 15:66671813-66671835 CTTTAGTGGATGGGGATCCCCGG - Intronic
1129541617 15:76354141-76354163 CTGAAATGGAAGAGCAGCCCAGG + Intronic
1129744102 15:78006452-78006474 CTCAGATGTCAGTGGATCCCAGG - Intronic
1132337393 15:101057076-101057098 CTCACATGGCAGGAGGTCCCAGG - Intronic
1133424214 16:5673570-5673592 GTCAAGTGGAAGGGGCTCCATGG + Intergenic
1136473799 16:30499291-30499313 GTTAAATGGTGGGGGATCCCAGG - Intronic
1137547044 16:49411555-49411577 CCCAAAGGGAAGGGGCTGCCTGG + Intergenic
1137593265 16:49706867-49706889 CTCACATGGCAGGTGGTCCCAGG + Intronic
1139308830 16:66011213-66011235 TTTAAGTGGAAGGTGATCCCAGG - Intergenic
1142601342 17:1054492-1054514 CTCAAAGGGATGGGGATACAAGG + Intronic
1143263476 17:5617765-5617787 CTCAAATGTTCGGGGATCCATGG - Intronic
1143474225 17:7193656-7193678 CGCAGATGGAAGGTGAGCCCTGG - Exonic
1149291346 17:55220580-55220602 CCCAAATGAAAGGTGATTCCAGG - Intergenic
1154162428 18:11990215-11990237 CTCACATGAAAGGTGAGCCCAGG - Intronic
1156380696 18:36558251-36558273 CACACAGGGAAGGGGAACCCTGG - Intronic
1157419281 18:47531765-47531787 TTCAATTAGAAGGGGATCACCGG - Intergenic
1158557592 18:58488058-58488080 CTCAAAGGAGAGGGGGTCCCTGG - Intronic
1159358537 18:67369387-67369409 CTCAAATGGATGGATATCACTGG + Intergenic
1162143010 19:8595963-8595985 CTCAGCTGGATGGGGGTCCCAGG + Intronic
1162152265 19:8655026-8655048 TTCTAATGAAAGGGCATCCCAGG - Intergenic
1162965286 19:14152626-14152648 CCCAAATGTGAGGGGATCCTTGG + Intronic
1164140233 19:22453663-22453685 CTCAACTGAAAAGGAATCCCAGG + Intronic
1166918835 19:46214304-46214326 CTCAAAGGGACAGGAATCCCGGG + Intergenic
925237215 2:2290287-2290309 CTCAGATGGAAGTGGAAGCCAGG - Intronic
927699597 2:25259367-25259389 TTCAACTGGGAGGGGATGCCAGG + Intronic
927783041 2:25954645-25954667 TTCAAACGGGAGGGGACCCCAGG + Intronic
929646938 2:43637425-43637447 CTCAAGGGGGCGGGGATCCCAGG - Intronic
937359199 2:121217438-121217460 CTCAAATGGAAGGAGTCCCACGG - Exonic
937672550 2:124553827-124553849 AACAAATGGAAGTGGCTCCCAGG + Intronic
939116524 2:138067854-138067876 TTCAAAAGGAAGGGGATGGCAGG - Intergenic
944290139 2:197995626-197995648 CTCAAATGCCAGGGATTCCCTGG - Intronic
945682913 2:212935324-212935346 CTCAAATGTAGGAGGAGCCCAGG + Intergenic
948910982 2:241002529-241002551 AGCAGATGGAAGGGGATCCTGGG + Intronic
1170933189 20:20787395-20787417 TTCATTTGGAAGGAGATCCCAGG - Intergenic
1172887590 20:38241510-38241532 CTCTAATGGAAGGGGCCCCCAGG + Exonic
1175387922 20:58608993-58609015 CTGAAATGGAAGGGGCTCATTGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179643753 21:42762986-42763008 CTAAAATGGAAGGGGTGGCCGGG - Intronic
1179891435 21:44337333-44337355 CTCACCTGGAAAGGAATCCCAGG - Intronic
1184001869 22:41680658-41680680 CTCAAATGGATGCGGAGCCATGG - Intronic
949862678 3:8520845-8520867 CACAAATGGAAGGAGATCAGAGG + Intronic
949974702 3:9445342-9445364 CTCCAAAGGAAGAGGAACCCGGG + Intronic
952202323 3:31143563-31143585 CTCATATTGATGGGGATACCTGG + Intergenic
955938739 3:64128076-64128098 CTCCCATGGAAGGAGCTCCCAGG + Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
959869466 3:111310126-111310148 CTCAAATAGAAGAAGAACCCTGG - Intronic
962824923 3:139092076-139092098 CTCTAGGGGAAGGTGATCCCAGG + Intronic
965515735 3:169619386-169619408 CACAAAAGGAAGGAGAGCCCTGG + Intronic
969121387 4:4913911-4913933 ATCAAATGGAAGGGGTCTCCAGG + Intergenic
970342548 4:15121789-15121811 GTCAAATGGAGGGGGCTACCTGG - Intergenic
974998959 4:69196760-69196782 CTCTGATGGAAGGGAATGCCTGG + Intronic
976455620 4:85244031-85244053 CTCTAATGGAAGTGGATGTCTGG - Intergenic
979606591 4:122645001-122645023 CCCAAAAGGAAGGGCAGCCCAGG + Intergenic
986943053 5:12980080-12980102 CTCCTATGGAAGAGGAACCCAGG - Intergenic
989826836 5:45866599-45866621 CTGAAGTGGAAGGGGCTGCCTGG - Intergenic
992829675 5:80582137-80582159 CACAAATGGAAGAGCATTCCAGG - Intergenic
994914351 5:105954520-105954542 CTCAAATGTAAGGAGATACGTGG - Intergenic
1000046766 5:157528308-157528330 CTGAAAGGGAGGGGGATACCGGG - Intronic
1001359950 5:171073177-171073199 CCAAAATGTCAGGGGATCCCAGG + Intronic
1001743429 5:174071840-174071862 CTCAAATGGAAGGGGATCCCCGG + Intronic
1002857898 6:1054736-1054758 CACAAGGGGAAGGGGGTCCCTGG - Intergenic
1007978484 6:46126084-46126106 CCCAAATGGAAGAGGTTCCTGGG - Intergenic
1012259104 6:97067224-97067246 CTGAAAAGGAAAGGGATACCTGG + Intronic
1014432454 6:121387372-121387394 CTCAGATGAAGGGCGATCCCCGG + Intergenic
1020177701 7:5896420-5896442 CTCAAAGGCAAGGGAATCCCAGG + Intergenic
1020305217 7:6828555-6828577 CTCAAAGGCAAGGGAATCCCAGG - Intergenic
1022504912 7:30903843-30903865 CTCAGAGGGAGGGGGATCTCTGG + Intergenic
1025094507 7:56087049-56087071 CTCAAGTAGCAGGGGAGCCCAGG + Intronic
1025188099 7:56876568-56876590 CTCAAGTGGCAGGGGAGCCCGGG + Intergenic
1025683824 7:63700354-63700376 CTCAAGTGGCAGGGGAGCCCGGG - Intergenic
1029081139 7:97974601-97974623 CTCAAAGGCAAGGGAATCCCAGG - Intergenic
1031620850 7:123931999-123932021 TTCATATGGAAGGGAATCACAGG - Intronic
1042954194 8:74230989-74231011 CTCAAAAGGAAGGGTATACTTGG + Intergenic
1044106611 8:88215455-88215477 GTCAAATGGCAAGGGATCCTGGG - Intronic
1044361387 8:91288696-91288718 CTGAAATGGAAGGGGAACTAGGG - Intronic
1057716895 9:97502298-97502320 CTCGACTGGACGTGGATCCCAGG + Intronic
1059383536 9:113946923-113946945 CTCAAATGGAATGGGCTGCAGGG - Intronic
1189101628 X:38196674-38196696 TTCATTTGGAAGGTGATCCCAGG + Intronic
1189552807 X:42111016-42111038 GTCAAATGGAAGGGGTCCTCTGG + Intergenic
1195245600 X:102992509-102992531 GCCAAATGGGAGGGGGTCCCTGG + Intergenic
1200212340 X:154352264-154352286 GTGAACTGGAAGGGGCTCCCAGG + Exonic
1201475414 Y:14376206-14376228 CTCTGATGGAAGGGAATGCCTGG - Intergenic