ID: 1001744588

View in Genome Browser
Species Human (GRCh38)
Location 5:174082508-174082530
Sequence CTGGCTTCCCTCCCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001744583_1001744588 29 Left 1001744583 5:174082456-174082478 CCAGGCTGCACACACTGAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 251
Right 1001744588 5:174082508-174082530 CTGGCTTCCCTCCCTGTTGCAGG No data
1001744585_1001744588 10 Left 1001744585 5:174082475-174082497 CCAGCACATGGTCTTTCCTTCTT 0: 1
1: 0
2: 7
3: 50
4: 487
Right 1001744588 5:174082508-174082530 CTGGCTTCCCTCCCTGTTGCAGG No data
1001744587_1001744588 -6 Left 1001744587 5:174082491-174082513 CCTTCTTGCATCAGAGTCTGGCT 0: 1
1: 0
2: 0
3: 19
4: 188
Right 1001744588 5:174082508-174082530 CTGGCTTCCCTCCCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001744588 Original CRISPR CTGGCTTCCCTCCCTGTTGC AGG Intronic
No off target data available for this crispr