ID: 1001745287

View in Genome Browser
Species Human (GRCh38)
Location 5:174087987-174088009
Sequence CAGAACAATGGGCAGTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001745282_1001745287 22 Left 1001745282 5:174087942-174087964 CCTAGAGAATTGAGGTCTCTAAT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1001745287 5:174087987-174088009 CAGAACAATGGGCAGTAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 158
1001745281_1001745287 23 Left 1001745281 5:174087941-174087963 CCCTAGAGAATTGAGGTCTCTAA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1001745287 5:174087987-174088009 CAGAACAATGGGCAGTAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001745287 Original CRISPR CAGAACAATGGGCAGTAAAC AGG Intronic
902599548 1:17531793-17531815 CAGAACAATGGGCTCTTATCCGG - Intergenic
902719817 1:18296469-18296491 CTGAGCTAAGGGCAGTAAACTGG + Intronic
904036138 1:27559776-27559798 CAGACAAATGGGCAGGAAGCAGG - Intronic
906725595 1:48041924-48041946 CACATCACTGGCCAGTAAACAGG - Intergenic
907917398 1:58883434-58883456 AAGAACAATGGACAGGAAATTGG + Intergenic
908267161 1:62390722-62390744 CAGCACAATGGGGAGAAAACAGG + Intergenic
909240444 1:73205779-73205801 GAGAGCAATGGGCAGTAGATAGG - Intergenic
914413134 1:147451150-147451172 CAGAACAATGGGAGCTAAAAAGG + Intergenic
914909376 1:151771756-151771778 CATCAGAATGGGCTGTAAACAGG + Intronic
916555065 1:165887367-165887389 CTGTACAATGGCCAGTAAAATGG - Intronic
917243070 1:172970453-172970475 CAGAACAATGGGCACTATGAAGG + Intergenic
918355082 1:183700397-183700419 CAGAAAAATGGACAGAAAGCAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920572627 1:207029194-207029216 CAGAACACTGGGGGGAAAACAGG + Intronic
921063348 1:211605202-211605224 CAGCACAATGGGCAGCACAGAGG + Intergenic
922445150 1:225690789-225690811 CATAAAAATGGGGAGTAACCAGG + Intergenic
922909763 1:229205723-229205745 CAGGACAGTGGGGAGTAAACGGG - Intergenic
1064759214 10:18601553-18601575 CAGAACTAGGAGCAGGAAACAGG + Intronic
1064890684 10:20169260-20169282 TATAACAATGGGTAGTAAACTGG - Intronic
1068783948 10:60949504-60949526 CAGAACAGTGGGAAGAAAATAGG - Intronic
1069340284 10:67401768-67401790 GAGAGCAATGGGCAGTAGATAGG - Intronic
1071041484 10:81314328-81314350 AAGACCAATGGGCAGTCATCAGG + Intergenic
1071815197 10:89225233-89225255 GAGAACAAAGGACAGAAAACAGG + Intronic
1071908339 10:90200516-90200538 CAGAACAACAGGCAGGAACCAGG - Intergenic
1072210392 10:93240938-93240960 CACAACAATGAGCAGAAATCAGG + Intergenic
1075828955 10:125387593-125387615 CAGAAAAATGGGCAAAAGACTGG - Intergenic
1076580211 10:131502972-131502994 CAGAATGCTGAGCAGTAAACAGG + Intergenic
1079441021 11:20515031-20515053 CAAAACAATGGAAAGAAAACAGG - Intergenic
1079709635 11:23665808-23665830 AAGGATAATGGGCAGTAGACAGG + Intergenic
1079709640 11:23665848-23665870 TAGGATAATGGGCAGTAGACAGG + Intergenic
1079747955 11:24156243-24156265 AAGAATAATGGGCAGTAGATAGG - Intergenic
1084657629 11:70528492-70528514 TTGAACACTGCGCAGTAAACGGG - Intronic
1088131688 11:106499136-106499158 CAGATCAATGTGAAGTCAACAGG - Intergenic
1088750471 11:112838315-112838337 CAGAAATATGAGCAGTAAATTGG - Intergenic
1093151342 12:15625429-15625451 CAGAAAAATGGGCAGTAGCTGGG - Intronic
1095177534 12:39110447-39110469 TAGAACAAAGGGCTGTAAAAAGG - Intergenic
1095783753 12:46087915-46087937 CAGGCAAATGGGAAGTAAACTGG + Intergenic
1097907705 12:64937478-64937500 CAGTTCAATGGGAAGTAAAATGG - Intergenic
1099533273 12:83814313-83814335 CAGAACAAAAGGCAAGAAACTGG - Intergenic
1101279235 12:103234542-103234564 CAGTACACTAGGCAGTAAATGGG - Intergenic
1102549472 12:113681033-113681055 CAGGACAATGGGCAATAAACAGG + Intergenic
1102928666 12:116845942-116845964 AAGAACATTTGGCAGTTAACTGG - Intronic
1106421949 13:29592512-29592534 CAGAAGGATGGGCATCAAACTGG - Intronic
1107426172 13:40295162-40295184 CTGAAGAATGGGGAGGAAACTGG + Intergenic
1109529763 13:63626649-63626671 AACAATAATGGGCAGTAAATTGG - Intergenic
1109705808 13:66091376-66091398 CAAATCAAGGGTCAGTAAACTGG + Intergenic
1111025826 13:82521575-82521597 AAGAAAAATGAGCAGTAGACTGG - Intergenic
1113218475 13:108070578-108070600 CAGAACATTGTGCAGTAAAATGG - Intergenic
1115725185 14:36206769-36206791 CAGGACAAAGGACACTAAACAGG - Intergenic
1117642401 14:57813754-57813776 CAGAACAATGGGCACTGGCCTGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117892549 14:60442113-60442135 CAGAATAATGTTCATTAAACTGG + Exonic
1119028100 14:71169699-71169721 AAGAGCAGTGGGCAGTCAACTGG - Intergenic
1119984536 14:79122237-79122259 CAGATTAATGAGCAGCAAACAGG + Intronic
1121987054 14:98517152-98517174 CAGGACAAAAGGCAGTAACCAGG + Intergenic
1121988366 14:98529917-98529939 CAGAACAAAGTGACGTAAACCGG + Intergenic
1122515315 14:102304570-102304592 CTGAACATTCGGCAGAAAACGGG - Intronic
1122925409 14:104897303-104897325 CATAAAAATAGGCAGTAAGCAGG + Intergenic
1125204959 15:37143524-37143546 GAAAACAAAGAGCAGTAAACTGG - Intergenic
1125833154 15:42730220-42730242 AACATCAATGGGCAGTACACGGG + Intronic
1126170678 15:45692942-45692964 CAGGACAATAGGTATTAAACAGG - Intergenic
1126987225 15:54326239-54326261 CAAAACAATGGGCTGTGAAATGG + Intronic
1127501584 15:59558796-59558818 CAAATCAATGGTCAGGAAACAGG + Intergenic
1129950682 15:79588226-79588248 GAGAACAACTGGCAGTTAACAGG - Intergenic
1129963247 15:79709381-79709403 CATAACAATGGCCAATAAATAGG - Intergenic
1130961218 15:88659734-88659756 CAGAACACTGGACAGGAAGCTGG - Intergenic
1134755942 16:16667478-16667500 GAGAAGAATGGACAGTAAACAGG + Intergenic
1134990126 16:18691686-18691708 GAGAAGAATGGACAGTAAACAGG - Intergenic
1135377688 16:21963438-21963460 CAAAACATTGGGAAGGAAACAGG - Intronic
1136387246 16:29936529-29936551 CAGAACAAAGGGTAGGAAAACGG + Intergenic
1141625411 16:85258856-85258878 CAGAACAATGGGCAGAACAACGG - Intergenic
1142112203 16:88338948-88338970 CAGAACAAAGTGCCATAAACTGG - Intergenic
1142115717 16:88355101-88355123 CAGAACACTGGGCAGAACACTGG + Intergenic
1145761099 17:27425846-27425868 CAGAACACTGGGCAGTGTCCCGG - Intergenic
1149772857 17:59334476-59334498 CATCACAATGGGAAGTAACCAGG - Intronic
1150032682 17:61755780-61755802 AAGAACAATGGAGAGTAAATAGG + Intronic
1150243696 17:63657158-63657180 CAGCACAATTGGCAGTAGAGTGG + Intronic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1152223641 17:79082691-79082713 CAGAATCACGGGCAGTAAAGAGG - Intronic
1157876139 18:51275348-51275370 CAGAACAGTGGGCAGAACTCAGG - Intergenic
1159367742 18:67491438-67491460 CAGAACACTCAGAAGTAAACAGG + Intergenic
1160315382 18:77839545-77839567 CAGAATACTGGGCAGTTAAGTGG + Intergenic
1160373991 18:78397007-78397029 CAGAACAAAAGGCAGCATACTGG - Intergenic
1161837934 19:6660343-6660365 CAGGACAATAGACACTAAACAGG + Intergenic
1163431622 19:17271423-17271445 TAGAAGAATGGGCACTGAACTGG - Intronic
1164499131 19:28798778-28798800 GAGAGCCATGGGCAGTAGACAGG - Intergenic
1164914409 19:32039314-32039336 CAGAGTAATGGGCAGAAAATGGG - Intergenic
925945179 2:8855440-8855462 GAGAAAAATGTGCAGTAAAAAGG - Exonic
927301288 2:21518777-21518799 CAGAAAAATGAGCAGGCAACTGG - Intergenic
929703234 2:44183421-44183443 CAGAATAATAGGCATTTAACTGG + Intronic
931358525 2:61558115-61558137 CAGAACTCTTGGTAGTAAACTGG + Intergenic
934168668 2:89320832-89320854 CAGAAAAATGGGCAGAATAAGGG - Intergenic
934198622 2:89861751-89861773 CAGAAAAATGGGCAGAATAAGGG + Intergenic
936958210 2:118044683-118044705 CAGAACCATGGGGACTGAACAGG + Intergenic
940494715 2:154411717-154411739 CAGAAAAATGTGCGGTAAAAAGG - Intronic
940701111 2:157043724-157043746 AAGAACAATGGGCCGTTTACAGG + Intergenic
944975925 2:205050910-205050932 CAGAACAACGGGCACTAACCAGG - Intronic
945367695 2:208976717-208976739 CAAAACTATGGGGAGTAATCTGG + Intergenic
948611807 2:239174344-239174366 CAGAAAAATGGGCAAGAGACTGG + Intronic
1170221917 20:13950466-13950488 GGGAACAATGAGCAGTAAAAAGG + Intronic
1170667750 20:18401459-18401481 CAGAAGTATGGGCAGTAAAGTGG - Intronic
1172698263 20:36836897-36836919 CAGAACCAGGGGAGGTAAACAGG - Intronic
1175553508 20:59831904-59831926 CAGAACCATGGCCAGGAAAAGGG - Intronic
949677400 3:6471676-6471698 CAGAAAAATTGCAAGTAAACTGG - Intergenic
949803540 3:7929762-7929784 AAGAAGCATGGACAGTAAACAGG - Intergenic
949973207 3:9429394-9429416 TAGAACAATGGGAAGTACATAGG - Intronic
953770206 3:45773931-45773953 CATCACAATGGGCACTAAGCAGG + Intronic
955201379 3:56854929-56854951 CAGAAATGTGAGCAGTAAACAGG + Intronic
957254949 3:77825157-77825179 GAGAGCAATGGACAGTAAATAGG + Intergenic
960790216 3:121421817-121421839 CACACCAATTGGAAGTAAACAGG + Exonic
962454434 3:135552146-135552168 AAGAACAATGGGAAAAAAACTGG - Intergenic
963382553 3:144550289-144550311 CAAATCCAGGGGCAGTAAACGGG + Intergenic
965758392 3:172049182-172049204 CAGACCAAGGGGGAGTAAAGAGG - Intronic
967336006 3:188345474-188345496 CCCAACAATGTGCAGGAAACAGG - Intronic
969259843 4:6026409-6026431 AAGAGAAATGGGAAGTAAACAGG + Intronic
969389022 4:6876897-6876919 CAGAACAAAGGCCAGAGAACAGG - Intronic
970208250 4:13678730-13678752 CAGAACAGGGGTCAGTGAACTGG - Intergenic
973795409 4:54420499-54420521 CAGAAGAATGGGTAGGAATCAGG - Intergenic
974011050 4:56607689-56607711 CAGAAATATGGACAGTAACCTGG + Intergenic
977239575 4:94551273-94551295 CAGCACTATTGGCATTAAACAGG - Intronic
977709990 4:100113912-100113934 GAGAAGAATGGGCAGGAGACAGG - Intergenic
981858628 4:149326884-149326906 GAGAACAGTGGGCAGTAATGGGG - Intergenic
984080535 4:175243846-175243868 CAGACCAACAGGCAATAAACAGG - Intergenic
988075284 5:26344496-26344518 CAGGAAAATTGGCAGTAGACAGG + Intergenic
992208910 5:74458403-74458425 GAGAACACTGCCCAGTAAACAGG + Intergenic
993987149 5:94610967-94610989 AAGGAAAATGGACAGTAAACTGG + Intronic
996522149 5:124438980-124439002 CAGAACAATGGGGGGAAACCAGG + Intergenic
999580470 5:153032803-153032825 GAGAAAAATGGGCATTAAAGGGG - Intergenic
1001745287 5:174087987-174088009 CAGAACAATGGGCAGTAAACAGG + Intronic
1004016773 6:11738527-11738549 CAGATCAATGGCCAGTATAATGG - Intronic
1004389712 6:15199671-15199693 GAGTACAAAGGGCAGTAAAAAGG + Intergenic
1007423201 6:41731964-41731986 CAGAAGAAAGGCCAGGAAACAGG + Intronic
1007532161 6:42552827-42552849 CAGACCAATGGGAAATAAATAGG - Intergenic
1008136262 6:47780537-47780559 CAGAACAAGAGGCAGTCAAAGGG + Intergenic
1012813149 6:103986269-103986291 CAGAAGAATGGGCTGGAAATTGG - Intergenic
1013066858 6:106692624-106692646 AATAAGAATGGGCTGTAAACAGG - Intergenic
1015031151 6:128597519-128597541 AAGAACAGAGGGCAGTAACCAGG - Intergenic
1017856757 6:158356573-158356595 CAGAAAAATGGGCAGTTAGGTGG + Intronic
1019150115 6:169999963-169999985 CAGGACAATGGGAAGTCAAGGGG - Intergenic
1020944838 7:14590411-14590433 AAGAACAATGGTGAGTCAACTGG - Intronic
1022861277 7:34369550-34369572 CAGAAAAATGAGCAATAAAGGGG - Intergenic
1023771303 7:43559014-43559036 CTGAACAATTGGCAGCAAAGAGG + Intronic
1028042220 7:86067422-86067444 GAAAACAATGGGCAGGAGACTGG + Intergenic
1028411286 7:90532828-90532850 CAAATCAATGGGCAGGAAAGTGG - Intronic
1029895545 7:103979603-103979625 CAGAACTTTGAGCAGTGAACAGG + Intronic
1031445770 7:121851807-121851829 CCTAACAAGGGGAAGTAAACTGG + Intergenic
1031734897 7:125346432-125346454 CAAAACATTTGACAGTAAACTGG - Intergenic
1034571574 7:151960424-151960446 CAGGAAAATGGGCTGTAAAGGGG - Intronic
1037208669 8:16357840-16357862 CAGAACAATGGGAGATAAAGAGG - Intronic
1039889294 8:41673400-41673422 CAGAACCAGGGGTAGTAACCAGG + Intronic
1043523770 8:81074158-81074180 CAGAACAATGGACAGAATAGCGG + Intronic
1049126612 8:140794955-140794977 CTGAACAATGGGAAGTATGCAGG - Intronic
1050364528 9:4862037-4862059 AAGAAAAATGGGAAGAAAACAGG - Intronic
1050518154 9:6467449-6467471 CAGAACAATGGGCCCCAAAGAGG - Intronic
1051931946 9:22396351-22396373 GAGAACAATAGGAAGGAAACTGG + Intergenic
1051932808 9:22406796-22406818 AACAGTAATGGGCAGTAAACAGG - Intergenic
1053211175 9:36229772-36229794 TAGAAGGATGGGCAGTAGACAGG + Intronic
1057000888 9:91508304-91508326 TATAAAAATAGGCAGTAAACTGG + Intergenic
1059128565 9:111719597-111719619 AAGAACAATTGTCAGCAAACTGG - Intronic
1060224074 9:121780818-121780840 CAGAACAATGAGCAGTAGCTGGG - Intronic
1060919833 9:127412644-127412666 CAGAACAAGGGGCAGTACCAGGG - Intergenic
1062002555 9:134224049-134224071 CAGAAAAAGGTTCAGTAAACTGG - Intergenic
1189323771 X:40101110-40101132 CAGAACAATTGGAACTAACCGGG - Intronic
1191716170 X:64195198-64195220 CAGACCCAGGGGCAGAAAACTGG - Intronic
1191726794 X:64290275-64290297 CAGGACAAAGAGCACTAAACTGG + Intronic
1192080237 X:68040760-68040782 CAGAGCCAGGGGCAGAAAACAGG - Intergenic
1193256172 X:79351678-79351700 GAGAACAATGAGTACTAAACTGG + Intergenic
1195334038 X:103832061-103832083 CAACACAATGGGAAGGAAACAGG + Exonic
1197388105 X:125826259-125826281 GAGAGCAATGGGCAGTGAATGGG + Intergenic
1197533920 X:127663904-127663926 AAGAACAATGGTCTGTAAATAGG - Intergenic
1198277698 X:135112301-135112323 GAGAGCAATGGGCAGTAGACAGG + Intergenic