ID: 1001746276

View in Genome Browser
Species Human (GRCh38)
Location 5:174095004-174095026
Sequence AGTGTAATGAGAGCAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001746273_1001746276 15 Left 1001746273 5:174094966-174094988 CCAGTGGGCTGAGTGCTAAGTGG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1001746276 5:174095004-174095026 AGTGTAATGAGAGCAAAACTAGG 0: 1
1: 0
2: 0
3: 23
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001746276 Original CRISPR AGTGTAATGAGAGCAAAACT AGG Intronic
901087673 1:6621477-6621499 AGTGTAATGAGTGCCACACCTGG + Exonic
903427559 1:23265698-23265720 ATTGTCTTGAGAGCAAAATTAGG - Intergenic
904577817 1:31516752-31516774 AGTGTATTGAAAGCCAAAATAGG + Intergenic
904982570 1:34519029-34519051 ATTGTTGTGAGAGCAAAATTTGG + Intergenic
906340309 1:44973940-44973962 AGGGTAATGAGAAGAAAATTTGG - Intronic
907952706 1:59198970-59198992 AGTGTCACTTGAGCAAAACTTGG - Intergenic
908573741 1:65437664-65437686 AGTGTAAGTAGAAAAAAACTAGG + Intronic
909399171 1:75207262-75207284 AGTAGAACAAGAGCAAAACTAGG - Intronic
909932612 1:81514932-81514954 AGTGAAATGATAGAAAAACAAGG + Intronic
910236012 1:85037318-85037340 TGTGTAATGGGAGGTAAACTGGG + Intronic
910792726 1:91067967-91067989 TGGGTAAGAAGAGCAAAACTCGG - Intergenic
911137351 1:94455347-94455369 TGGGCAATAAGAGCAAAACTCGG - Intronic
912953775 1:114138187-114138209 AGTGTATGCAGAGCAAAAGTGGG - Intronic
913543769 1:119846541-119846563 AGTGTACTGGGACCAAAATTCGG + Intergenic
914356568 1:146890363-146890385 ACTCTTATGACAGCAAAACTTGG + Intergenic
915377087 1:155405901-155405923 ACTGTTAAGACAGCAAAACTTGG + Intronic
916155380 1:161840292-161840314 AGTGGAATGAGCACAAAATTTGG - Intronic
916765401 1:167855294-167855316 TGGGCAATGAGAGCGAAACTAGG + Intronic
917589765 1:176463949-176463971 AGGGTTATGAGAGGAAAAGTAGG + Intronic
917668171 1:177245936-177245958 ATTTTAATTAGAGCAAAATTGGG + Intronic
918151944 1:181804857-181804879 AGTGAAATTAAAGCAAATCTTGG - Intronic
918299762 1:183192422-183192444 ACTGTAATAAGAGAAAAACATGG - Intronic
919402368 1:197135403-197135425 AATGTAATCAGAGCAAAATGGGG + Intronic
920780770 1:208989050-208989072 GGTGTGGTGAGAGGAAAACTTGG - Intergenic
921195458 1:212752807-212752829 AGTGACCTGAAAGCAAAACTAGG - Intronic
921323794 1:213970678-213970700 AGTGAAATGAAAGCAAACTTTGG - Intergenic
923663662 1:235980013-235980035 AGAGTAATGAGGGCAAGAGTGGG + Intronic
924252817 1:242152354-242152376 AGTGTAATAAGAAAAAAAATAGG - Intronic
1064546885 10:16459770-16459792 TGAGTAAGGAGAGCAAAACTTGG - Intronic
1065491485 10:26286601-26286623 AGTTTAAAGAAAGCAAATCTTGG - Intronic
1065685259 10:28278006-28278028 AGGGCAATGAGACCAAAGCTTGG + Intronic
1067956864 10:50801147-50801169 GGGGTTATGAGAGGAAAACTAGG + Exonic
1067966204 10:50915782-50915804 GGTGTAGAGAGAGCAAAACAAGG - Intergenic
1068468537 10:57428113-57428135 AGGGTAATAAGAGAAAAACATGG - Intergenic
1068537352 10:58255221-58255243 AGTGTATTGGGAACAAAAGTGGG - Intronic
1070255828 10:74812509-74812531 TGGGTAACAAGAGCAAAACTCGG + Intergenic
1070381703 10:75886067-75886089 GGTGGAAGGAAAGCAAAACTAGG - Intronic
1071275912 10:84054842-84054864 TGTGTAATGACAGGAACACTCGG - Intergenic
1071451612 10:85797451-85797473 TGGGCAATAAGAGCAAAACTTGG - Intronic
1072225905 10:93368436-93368458 ATTGCAATGATTGCAAAACTAGG - Intronic
1072665218 10:97387915-97387937 TGTGCAACAAGAGCAAAACTCGG + Intronic
1073600011 10:104837598-104837620 TGTGTAATGAGAAAAGAACTAGG - Intronic
1073790222 10:106932649-106932671 GGTGTCCTTAGAGCAAAACTTGG - Intronic
1074734407 10:116413779-116413801 ATTGTATTGAGAAGAAAACTGGG - Intergenic
1076133016 10:128026601-128026623 AGTGTTAAGAGAGAAAAAGTGGG - Intronic
1078000229 11:7488501-7488523 AGAGTAATGAGAGTAAGAATTGG + Intronic
1079353123 11:19709766-19709788 TGGGAAATTAGAGCAAAACTCGG + Intronic
1080021182 11:27561769-27561791 AGTGTAGTAAGAGCAAGTCTGGG - Intergenic
1080508077 11:32937742-32937764 AGTGGAAAGAGAGTAAAACATGG - Intronic
1080794311 11:35549360-35549382 AGTATAATAAGAGCTAAAATAGG - Intergenic
1081084067 11:38777186-38777208 ATTGCAATGAAAGCAAAAATTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081319788 11:41677545-41677567 ATTCTAATGAAAGCAAAACCAGG + Intergenic
1083506753 11:63164982-63165004 AGTGTCATGTGGGCAATACTAGG + Intronic
1084071382 11:66738189-66738211 TGGGCAATAAGAGCAAAACTCGG + Intergenic
1084524292 11:69686261-69686283 TGGGCAATAAGAGCAAAACTCGG - Intergenic
1086388537 11:86336256-86336278 AGTGTAATGAGAGTAACATATGG + Intronic
1086723023 11:90145113-90145135 AATGAAATGGGAGAAAAACTTGG + Intronic
1087332326 11:96796538-96796560 AGTTTCATGAGTGGAAAACTTGG + Intergenic
1087503864 11:98995905-98995927 AGTGTAATGAAAAACAAACTTGG + Intergenic
1088680423 11:112236888-112236910 AGTGTAATGAGAAATGAACTTGG + Intronic
1089570439 11:119404629-119404651 AGTAAAAGGAGAGTAAAACTAGG - Intergenic
1090132082 11:124154018-124154040 AGTGGAAAGAGAGCTAAACCTGG + Intergenic
1090256671 11:125289221-125289243 AGTGGAATGAGACCCAAAATGGG + Intronic
1090950607 11:131469801-131469823 AGAATAATGAGAGCCAAGCTTGG + Intronic
1091418684 12:315126-315148 AGTGGAATGAGAGAAAAAGAAGG + Intronic
1093037800 12:14349518-14349540 AGTGAAATTATAGCAAAATTAGG + Intergenic
1093385112 12:18543409-18543431 ATCGCAATGAGAGCAAAAATTGG - Intronic
1096393924 12:51251021-51251043 TGTTTAAAGAAAGCAAAACTAGG - Intronic
1097726590 12:63081909-63081931 ATTGTAATTAGAGCAAACATAGG + Intergenic
1098947174 12:76601816-76601838 AGTGGAATGAGAGGTAAACGGGG - Intergenic
1099939426 12:89167725-89167747 TGTGTAATATGAGTAAAACTGGG + Intergenic
1100120245 12:91361235-91361257 AGTGTGATTAGAGCCAAACAGGG - Intergenic
1101011257 12:100452114-100452136 AGTGGAATGAGAGTATAAATTGG + Intergenic
1102712876 12:114943704-114943726 AGAGGAAGGAGAGCAAATCTTGG - Intergenic
1108551356 13:51548786-51548808 AGCATAATGGGATCAAAACTTGG + Intergenic
1110159944 13:72363817-72363839 AGAGTAAAGAGAGAGAAACTGGG - Intergenic
1110763076 13:79252054-79252076 AGGGTAATGAGATCCAAAATGGG + Intergenic
1110838130 13:80108690-80108712 TGTGAAATGAGAGAAAAAGTAGG - Intergenic
1111027910 13:82556863-82556885 AGGGCAATTAGAGCAAAACGTGG + Intergenic
1111554565 13:89863425-89863447 AGTGGAATGAGAGGAAAAGATGG - Intergenic
1113581134 13:111429953-111429975 AGTGTTACGAGTGCAAATCTTGG + Intergenic
1113581138 13:111430007-111430029 AGTGTTACGAGTGCAAATCTTGG + Intergenic
1113581142 13:111430061-111430083 AGTGTTACGAGTGCAAATCTTGG + Intergenic
1113581146 13:111430115-111430137 AGTGTTACGAGTGCAAATCTTGG + Intergenic
1114358076 14:21937043-21937065 AGTGTTATCAGAGTAAAATTTGG - Intergenic
1114399723 14:22398694-22398716 ACTGTATTCAGAGCAAAGCTTGG + Intergenic
1115086471 14:29521446-29521468 AGTCTAATGAGACCAATAATAGG - Intergenic
1117521025 14:56551672-56551694 AATTTAATGAGGGCATAACTGGG + Intronic
1117709068 14:58504865-58504887 AGTGTGATAAGAGCAACATTAGG - Intronic
1117866802 14:60158432-60158454 AGTGTGATGATTGCAGAACTTGG - Intronic
1118181705 14:63500243-63500265 ACTTTAATGAAAGTAAAACTTGG + Intronic
1118277700 14:64400362-64400384 TGGGCAATGAGAGCAAAACTTGG + Intronic
1119429444 14:74556538-74556560 TGGGCAACGAGAGCAAAACTCGG - Intronic
1120315862 14:82891699-82891721 AGTTTATTGAAAGCAAAAGTAGG - Intergenic
1120504386 14:85336659-85336681 AGTGAAATAAAAGCAATACTTGG - Intergenic
1122009167 14:98731563-98731585 AGAGTCATTAGAGCAAGACTTGG - Intergenic
1124048195 15:26170636-26170658 ACTTTAATGAGAGCAAAGCATGG - Intergenic
1124992773 15:34692294-34692316 AGTTGATTGAGAGCAAAAATGGG - Intergenic
1125040750 15:35184611-35184633 ATTGTAAAAAGAGGAAAACTGGG + Intergenic
1125265664 15:37877832-37877854 AGAGAAATGAGAGATAAACTGGG - Intergenic
1125299793 15:38242673-38242695 AGTCTAAAAAGAGCAAAACCAGG + Intergenic
1127222779 15:56897815-56897837 AGTGTCTTGAGAGCAGAACATGG + Intronic
1128373323 15:67057188-67057210 GGTGTGATGAGAGCAGAACAAGG - Intergenic
1128773933 15:70304291-70304313 AGTGTATTGAGAGAAAAATTAGG + Intergenic
1131664548 15:94556423-94556445 AAGGAAATGAGAGCAAAACAGGG - Intergenic
1131682252 15:94736484-94736506 AATGTAATGAGAGGAAAAGGTGG + Intergenic
1133504911 16:6402196-6402218 AGTGTACCAAGAGCTAAACTAGG + Intronic
1134327387 16:13219562-13219584 AAGGTAATCAGAGCAAAACCTGG - Intronic
1135342131 16:21658144-21658166 AGTGCACTGAGCACAAAACTGGG + Intergenic
1135785518 16:25345468-25345490 AATGGAATAAGAGAAAAACTAGG - Intergenic
1137048001 16:35686182-35686204 AATGTAATGATAGAGAAACTTGG - Intergenic
1137943206 16:52709160-52709182 TGTGTAATTAAAGCAAAAATAGG + Intergenic
1138996601 16:62461543-62461565 ACTATAATTAGAACAAAACTTGG - Intergenic
1139277214 16:65739206-65739228 AGTTCTATGAGAGCTAAACTGGG + Intergenic
1139977448 16:70825090-70825112 ACTCTTATGACAGCAAAACTTGG - Intronic
1141701240 16:85643075-85643097 AGTGTATTGAGGGCAAAAACAGG - Intronic
1144477694 17:15602930-15602952 AGGGCAACAAGAGCAAAACTCGG - Intronic
1145407902 17:22623632-22623654 ATAGAAATGAGAGCAAAGCTTGG - Intergenic
1145989344 17:29069544-29069566 AGGGTAATAAGAGCAATAATTGG - Intergenic
1146528490 17:33587494-33587516 AGTTTAGTGAGAGCAAAAACTGG + Intronic
1148788388 17:50158120-50158142 AGTCTAACAAGAGCAAAAGTTGG - Intergenic
1149027632 17:52048100-52048122 AGTTTGCTGAGAGCCAAACTGGG + Intronic
1149211001 17:54300963-54300985 AGTGTTATGAGAGAAAAATAAGG - Intergenic
1149823570 17:59804744-59804766 AGTGTAATGAAAACAAAACCAGG - Intronic
1150037035 17:61813221-61813243 AGTGAAATAAAAGGAAAACTAGG + Intronic
1151073435 17:71244385-71244407 TGGGCAATAAGAGCAAAACTCGG - Intergenic
1151150300 17:72079379-72079401 AGCCTATTGAGATCAAAACTAGG - Intergenic
1151438318 17:74112269-74112291 AGTTTTATGAGAGCAAGAGTGGG - Intergenic
1153397943 18:4646208-4646230 AGGGTAGTGAGAGCAAGACTAGG + Intergenic
1155244847 18:23897547-23897569 TGTTTAATGAGAACAACACTAGG - Intronic
1156232157 18:35164198-35164220 AGTGGAGGGAGAGAAAAACTGGG - Intergenic
1156911178 18:42412795-42412817 AGTAAAAAGAAAGCAAAACTAGG - Intergenic
1158475969 18:57779596-57779618 TGTGTAATGAAAGAAAAAATAGG + Intronic
1158944251 18:62434616-62434638 AGTTTAATAAAAGAAAAACTGGG - Intergenic
1161625888 19:5326400-5326422 AATGTGGTGAGAGCAAAACAAGG - Intronic
1164070951 19:21767529-21767551 AGAGAAGTGAGAGCAAAACCTGG + Exonic
1164372529 19:27654747-27654769 AGTCTAATGATAGAAACACTTGG - Intergenic
1164372548 19:27654887-27654909 AGTCTAATGATAGAAACACTTGG - Intergenic
1164380905 19:27736375-27736397 AGTCTAATGAAAGTGAAACTTGG - Intergenic
1164381453 19:27740018-27740040 AGTCTAATGAGAGAGAAACCTGG - Intergenic
1164381830 19:27742499-27742521 AGTCTAATGATAGAGAAACTGGG - Intergenic
1164384169 19:27759377-27759399 AGTCTAATGATAGAGAAACTTGG - Intergenic
1164692434 19:30221533-30221555 AATGTAATGAGAAAAAAACATGG - Intergenic
1166628579 19:44384596-44384618 ACTGTAATGCAAGAAAAACTAGG + Exonic
1167626087 19:50590318-50590340 ATGGTCATGTGAGCAAAACTGGG + Intergenic
1168468127 19:56620317-56620339 AGTGAAATGAGAGAAAAATCGGG - Intronic
928671549 2:33608247-33608269 AGTGTACTGGGAACAAAACAGGG + Intergenic
929298495 2:40274341-40274363 AATCTAATAACAGCAAAACTAGG + Intronic
929848639 2:45559496-45559518 AGTTTAATGAGAACAACACTGGG - Intronic
929924926 2:46200145-46200167 AGTGTAAAGAAAGCAAAAGCTGG - Intergenic
935024353 2:99262020-99262042 AGTCTAATTATAGCAAACCTCGG - Intronic
935679538 2:105623989-105624011 AATGTAATGAGACTGAAACTTGG + Intergenic
936451608 2:112637934-112637956 TGGGTAACGAGAGCGAAACTCGG - Intergenic
936767573 2:115872000-115872022 TGGGCAACGAGAGCAAAACTCGG + Intergenic
937786921 2:125910914-125910936 TGTGTATTGAGAAAAAAACTTGG + Intergenic
940210083 2:151247030-151247052 TGGGCAATAAGAGCAAAACTCGG + Intergenic
940566854 2:155375488-155375510 TGTGACTTGAGAGCAAAACTTGG - Intergenic
944244584 2:197518115-197518137 TGGGTAACAAGAGCAAAACTCGG + Intronic
946347908 2:219125914-219125936 AGTGGGATGAGAGCAGAACTGGG - Intronic
946614683 2:221496883-221496905 AGGGTGACAAGAGCAAAACTCGG + Intronic
1169605435 20:7313154-7313176 AGTGTAGTTAGAGCAACAATGGG - Intergenic
1169775241 20:9245175-9245197 AGTCTCTTGAGAGCTAAACTGGG + Intronic
1171044480 20:21797450-21797472 AGTGGAAGGGGAGCAAAGCTGGG + Intergenic
1171991601 20:31700789-31700811 AGTATCTTGAGAGCAGAACTGGG + Intronic
1172858924 20:38032351-38032373 AGTGCAATAAGAGCAAAAGCAGG + Intronic
1175027094 20:55913973-55913995 AATGGAGTGAAAGCAAAACTGGG - Intergenic
1177412462 21:20747978-20748000 AGAGTGATGAGAGTTAAACTAGG + Intergenic
1181668863 22:24416533-24416555 AGGCAAATGAGAGCAAAAGTGGG - Exonic
1181831074 22:25560859-25560881 AGTTTAATAAAAGCAAAGCTTGG + Intergenic
1183252115 22:36737552-36737574 AGAGGAATGAGAGCAACACACGG + Intergenic
949181607 3:1137923-1137945 TGTCTCAGGAGAGCAAAACTGGG - Intronic
952444252 3:33365071-33365093 AATATTATGAGAGGAAAACTAGG - Intronic
953711558 3:45275493-45275515 AGTCTAGTGAGAGCAGAGCTGGG + Intergenic
955244100 3:57207478-57207500 AGTGTAATGAGAAGAGGACTTGG + Intronic
955278981 3:57575573-57575595 AGTGAAATGACAGATAAACTAGG - Exonic
955448715 3:59043299-59043321 AGTGAAATGGGAAGAAAACTAGG + Intronic
956410103 3:68970346-68970368 AGTGAAATGAGAGTAGTACTAGG - Intergenic
957513942 3:81226446-81226468 ATTGTACTGAGTGCAAAATTTGG - Intergenic
957627767 3:82676755-82676777 AGTATAATGAAAGCAGAAGTAGG - Intergenic
957905502 3:86548659-86548681 AGTGTAAGGAGATCATAATTTGG + Intergenic
958149943 3:89678577-89678599 GGTGTAATGAGAGGAACACCAGG - Intergenic
959259058 3:104051661-104051683 ATTGCAATGAAAGCAAAAATTGG + Intergenic
959627773 3:108472029-108472051 AGGTTGTTGAGAGCAAAACTGGG - Intronic
960844324 3:121993014-121993036 AGTGTAATTTGGGCAAAACAGGG + Intronic
961579983 3:127873087-127873109 TGTTTGTTGAGAGCAAAACTAGG + Intergenic
961970810 3:130965188-130965210 AGTGGAATGAGACAAAGACTTGG - Intronic
963493695 3:146033550-146033572 AGTGCATTGAGATGAAAACTGGG + Intergenic
963543643 3:146627032-146627054 AGTGTCATAAAAGCAAAACTAGG - Intergenic
964520749 3:157563866-157563888 TGGGCAATAAGAGCAAAACTCGG - Intronic
964543439 3:157805062-157805084 AGGGCAATGAAAGCAAAACTTGG + Intergenic
965452790 3:168858948-168858970 AGTGTTACGAAGGCAAAACTGGG - Intergenic
965757976 3:172043864-172043886 AGTGTAATAAGAGTACAAATAGG + Intronic
966286714 3:178305618-178305640 TGGGCAATGAGAGCAAAACTTGG - Intergenic
966379325 3:179327164-179327186 TGGGTAACAAGAGCAAAACTCGG + Intronic
966816335 3:183892981-183893003 GGGTTATTGAGAGCAAAACTGGG + Intergenic
967079901 3:186040139-186040161 AGGGGAATGAGAGCAAATCTTGG + Intergenic
967727087 3:192872045-192872067 AGTTTTATGAGAGACAAACTTGG - Intronic
969161822 4:5266825-5266847 AGTTAAATGAGAGCAAGAGTAGG + Intronic
970099496 4:12504217-12504239 AGTATCATGAGAGCAGCACTGGG + Intergenic
971551233 4:27958765-27958787 AGGGTAATCAGAGCAATGCTGGG - Intergenic
975351818 4:73355789-73355811 AGTGAAGTCAGAGGAAAACTAGG - Intergenic
975538121 4:75473557-75473579 AGTGTGATGAGAGCTAAGGTGGG - Intergenic
978059562 4:104321127-104321149 AGTATAATTAGAGCAAAAATGGG + Intergenic
978611872 4:110550483-110550505 AATGGTATCAGAGCAAAACTGGG + Intronic
979333293 4:119440387-119440409 AGGGCAATGAGAACAAAATTCGG + Intergenic
979523456 4:121694334-121694356 AATGTCATGAAGGCAAAACTAGG - Intronic
979969397 4:127115156-127115178 ACTATTATGAGAGCAGAACTGGG - Intergenic
981901596 4:149871448-149871470 TGAGTAATGAGAGCAAAGATTGG - Intergenic
983203224 4:164884934-164884956 AGTGCTCTGAGAGCAAAAGTGGG - Intronic
985752674 5:1690342-1690364 TGGGCAATGAGAGCGAAACTTGG + Intergenic
987845787 5:23283172-23283194 AGTGTAAAGAAAGCAAATCCTGG + Intergenic
987943939 5:24579815-24579837 AGTGTAGTGAGAGAAGAACTAGG - Intronic
988514750 5:31894864-31894886 AGGGAAAGGAGAGCAAGACTGGG - Intronic
988574344 5:32405597-32405619 AGTGTCATGAGTGCCAGACTTGG - Intronic
988912481 5:35857774-35857796 ATTGTAATTATAACAAAACTAGG + Intronic
990036164 5:51322826-51322848 AGTGAAATTACAGAAAAACTGGG + Intergenic
993144962 5:84082175-84082197 AGTATTATCATAGCAAAACTTGG - Intronic
993401216 5:87454260-87454282 TGTCTAATTTGAGCAAAACTAGG + Intergenic
993539845 5:89135256-89135278 ACAATAATGAGAGAAAAACTGGG + Intergenic
994679555 5:102868565-102868587 AGTGTAATGAGATTGAGACTAGG + Intronic
995153088 5:108874276-108874298 GGTATAATGAGACCAAAATTAGG + Intronic
995331527 5:110952725-110952747 TGAGTAATGAGAGCAATAGTGGG - Intergenic
995340255 5:111050556-111050578 TGGGCAACGAGAGCAAAACTCGG - Intergenic
995348064 5:111143584-111143606 AGTGAAATGAGAATAAAAGTAGG + Intergenic
1000871895 5:166587647-166587669 AGTATATTGAGAGTAAAATTTGG - Intergenic
1001746276 5:174095004-174095026 AGTGTAATGAGAGCAAAACTAGG + Intronic
1002583035 5:180222024-180222046 AGTGACATGGGAGCAAAACGAGG + Intergenic
1003325803 6:5089703-5089725 ACTGGGAGGAGAGCAAAACTAGG - Intergenic
1005766618 6:29017228-29017250 ATTGTAATGAGAACAAACTTCGG - Intergenic
1006626055 6:35398679-35398701 AGTGATATCAGAGCAAAACCTGG + Intronic
1008284765 6:49635597-49635619 AGTGTAAAGACAGCTAGACTTGG + Intronic
1008475717 6:51933762-51933784 AGTGGAATGTGAGCAGAACTGGG - Intronic
1009798618 6:68503675-68503697 AGTGTAAAGAAATCAAAACAAGG + Intergenic
1012025153 6:93980163-93980185 AGTGCAATGAGAACAGAACTTGG + Intergenic
1012620369 6:101337396-101337418 AGATTAATGAGACCAAAAGTTGG - Intergenic
1013979714 6:116115208-116115230 AGTATAATGTGAAAAAAACTGGG - Intronic
1014548220 6:122756871-122756893 AGTGAAATGAGAGGAAAACAAGG - Intergenic
1015142165 6:129947350-129947372 AGTGAAATGAGAACACAACAAGG - Intergenic
1016309359 6:142716400-142716422 TGTGTAATGACTGCACAACTGGG + Intergenic
1016393143 6:143594824-143594846 TGGTTAATGAGAGCAAAACAGGG - Intronic
1016875953 6:148864845-148864867 TGTGTACTGAGGGCAAAACAAGG - Intronic
1018159281 6:161022315-161022337 AGTTAAATGAGAGAAAAAGTGGG - Intronic
1021012683 7:15491275-15491297 AGTGTAATATGTGCAAAACTAGG + Intronic
1022000131 7:26218418-26218440 TGGGCAATGAGAGCGAAACTCGG + Intergenic
1024070750 7:45783277-45783299 AGGGCAATGAGAACAAAATTTGG - Intergenic
1024204468 7:47144959-47144981 AGTTTTTGGAGAGCAAAACTGGG + Intergenic
1024487552 7:49935809-49935831 AGTGGGATGAGAGCAAATCATGG - Intronic
1027789258 7:82618905-82618927 AGTGTAAAGAGTCCAAAATTAGG + Intergenic
1027802486 7:82773238-82773260 AGTATAATGTAAGAAAAACTAGG + Intronic
1028195852 7:87906820-87906842 AGAATAATGAAAGCAAAATTAGG + Intronic
1028556420 7:92130843-92130865 ACTGTAATGAGTGGAAAAGTAGG + Intronic
1028618302 7:92795449-92795471 AGTATACTCAGACCAAAACTAGG + Intronic
1031373660 7:120997896-120997918 TGGGTAACAAGAGCAAAACTCGG + Intronic
1033511535 7:142064590-142064612 AATGGAATGAAAGGAAAACTAGG - Intronic
1034512063 7:151543695-151543717 AGTTTCATGAGAGCAAAACAAGG + Intergenic
1034574775 7:151987595-151987617 AGAGTGAGGAGAGCAAGACTGGG + Intronic
1035887427 8:3307192-3307214 AGTGTAATGTAAGCACAAGTTGG + Intronic
1037192062 8:16138181-16138203 AGTGCAATGAGACTACAACTAGG - Intronic
1038161713 8:25045953-25045975 AATGTAATGAGAGCCAAAGGAGG + Intergenic
1040825321 8:51613580-51613602 AGTCGAATAAGAGAAAAACTTGG + Intronic
1043044075 8:75299179-75299201 AGGGTATTCAGAGCAAAACATGG + Intergenic
1044946118 8:97391664-97391686 AGTGAAATTAGAGCAAAGCAGGG + Intergenic
1045324861 8:101110377-101110399 ACTGTAATGAGAGCTAAATGAGG + Intergenic
1046676506 8:117114681-117114703 AGTCTACTGAGAGAAAAAGTGGG + Intronic
1048352356 8:133626441-133626463 AGTGGAATGAAAGGAAAACTGGG + Intergenic
1050354117 9:4767285-4767307 GGGGTAAGGAGAGGAAAACTAGG - Intergenic
1050752757 9:8960335-8960357 AGTGTAATGGTAGAATAACTGGG + Intronic
1051150455 9:14073642-14073664 TGGGCAATTAGAGCAAAACTTGG - Intergenic
1052529832 9:29667908-29667930 AGTGAAGTGAGAGCAAAAAATGG - Intergenic
1054863769 9:69979084-69979106 AGTGTAATGAAGGCAAAATTCGG + Intergenic
1055059088 9:72050314-72050336 GATGTAATGAGAGGAGAACTAGG - Intergenic
1058004933 9:99904716-99904738 AATGTAATGAGAAGAAGACTGGG - Intergenic
1058639944 9:107073879-107073901 AGTGCAATGTGAGCAGAGCTGGG - Intergenic
1061977727 9:134079312-134079334 AGTGAAATGACAGATAAACTAGG + Intergenic
1186182476 X:6986455-6986477 ACTGTAATGAAAGCATAACTGGG - Intergenic
1187106074 X:16243430-16243452 AGTTTAATGAGGGGAAATCTAGG - Intergenic
1187232330 X:17434899-17434921 AGGGCAATGTGAGGAAAACTAGG + Intronic
1187468031 X:19543461-19543483 AGGGTGCTGAGAGGAAAACTGGG + Intronic
1188403719 X:29780534-29780556 AGTGTTATGAGAGCAACAAATGG + Intronic
1188458168 X:30391169-30391191 TGTGGATGGAGAGCAAAACTGGG - Intergenic
1188677597 X:32961850-32961872 AGTATAATATGTGCAAAACTGGG - Intronic
1192430235 X:71106827-71106849 AGGGTAAGGAGAGAAAAACTTGG + Intergenic
1195011527 X:100736633-100736655 GGTCTAATGAGAGCAAACCTAGG + Intergenic
1195199204 X:102531780-102531802 AGTATAAAAAGAGTAAAACTAGG + Intergenic
1195539880 X:106051290-106051312 TGAGTAAAGAGAACAAAACTGGG + Intergenic
1196785587 X:119418959-119418981 AGTGTATTGAGAGAACAAGTAGG + Intronic
1197265641 X:124367684-124367706 AGTGTAATGAAATCAAACCCTGG + Intronic
1199530248 X:148838704-148838726 AGTGGAAAGAGAGGAAACCTGGG + Intronic
1199720943 X:150542374-150542396 AGTGTCAGGAGAGCTAACCTAGG - Intergenic
1201310141 Y:12589534-12589556 AGGGTAATGAGAAAAAACCTTGG + Intergenic
1201929510 Y:19327129-19327151 ACTGCAATGAAAGCAAAAATTGG + Intergenic