ID: 1001746667

View in Genome Browser
Species Human (GRCh38)
Location 5:174098000-174098022
Sequence CCTTCCCAGCAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001746667 Original CRISPR CCTTCCCAGCAGAAGGTGGC TGG Intronic
900287431 1:1908441-1908463 CCATCACTGCAGAGGGTGGCAGG + Intergenic
900410453 1:2510275-2510297 GCTCCTCAGCAGCAGGTGGCTGG - Intronic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
901012410 1:6209251-6209273 CTCTCCCTGCAGAAGGCGGCGGG - Exonic
901674952 1:10877736-10877758 CGATCCCAGCAGAAGGTTGCAGG - Intergenic
902649862 1:17829973-17829995 CCTTGGCAGCAGAAATTGGCAGG - Intergenic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
903779812 1:25814092-25814114 TCGTCCCACCAGAAGCTGGCTGG + Exonic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904970502 1:34415907-34415929 CCTTCCCAACATAGGGTGGAAGG + Intergenic
906669432 1:47643843-47643865 GCTTCCCAGGAGGAGGTGGCCGG + Intergenic
907440652 1:54476088-54476110 GGTTCCCAGCTGAGGGTGGCGGG + Intergenic
911125162 1:94334555-94334577 CCTACCCAGCAGAAACTGCCTGG - Intergenic
911360696 1:96873018-96873040 CCTACCCTGATGAAGGTGGCAGG + Intergenic
914703431 1:150153001-150153023 CCTTCCCAGCAGGAGACAGCTGG - Intronic
916538437 1:165728031-165728053 ACTTCCCAGAAGGAGGTGGTGGG + Exonic
916828918 1:168471204-168471226 CCTTCCCACCATAAGGAGGATGG + Intergenic
920561661 1:206943082-206943104 CCTCCCCAGCCCAGGGTGGCTGG + Intronic
921337429 1:214102309-214102331 CCTTCCTAGCTGAACATGGCTGG - Intergenic
923034124 1:230272289-230272311 CCTTCCCCAGAGAAGGTGGCCGG + Intronic
923084277 1:230690449-230690471 GCCTCCCAGAAGAATGTGGCTGG - Intronic
924954616 1:248914590-248914612 CCATCCCAACAGAAGGATGCAGG - Intronic
1062995329 10:1860538-1860560 CCCTCCCAGGAGGAGGTGACTGG - Intergenic
1063147702 10:3310941-3310963 ACTTCCCTCCAGCAGGTGGCTGG + Intergenic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1063506161 10:6601632-6601654 GCTTCACAGCAGAAGGTGAGTGG - Intergenic
1065067153 10:21981686-21981708 CCTTTTCAGCAGACGGTGCCAGG + Intronic
1065094068 10:22263553-22263575 CCTGCCCAGCACTGGGTGGCAGG - Intergenic
1065506023 10:26430914-26430936 CCTTCCGAACTTAAGGTGGCTGG - Intergenic
1065762565 10:28995910-28995932 CCTTCCCACCACAAGGCAGCAGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1071128160 10:82359893-82359915 CCATGCCAGCAGAAGCTGCCTGG + Intronic
1072410360 10:95196240-95196262 CCTACCCAGCAGAAGCTTCCAGG + Intronic
1072429122 10:95355822-95355844 GCTTCCCCCCAGAAGGGGGCTGG + Intronic
1074453374 10:113577318-113577340 CCTTCCATGCAGAAGGGTGCAGG - Intronic
1074534796 10:114321029-114321051 AGTTCCCAGCAGGAGGTGGCAGG + Intronic
1075731102 10:124637331-124637353 CATGCCCAGCACAAGGCGGCTGG - Intronic
1076724510 10:132407226-132407248 TCTTCCCAGCAGGAGAAGGCAGG + Intronic
1077116933 11:889431-889453 CCACCCCAGCAGATGGCGGCGGG - Intronic
1081975707 11:47233385-47233407 ACTTCCCAAGAGAAAGTGGCTGG + Intronic
1084650417 11:70486358-70486380 ACGTCCCAGCAGAAGTCGGCTGG - Intronic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1086362876 11:86077526-86077548 CCTTCCCTGCCAAAGATGGCAGG + Intergenic
1087637593 11:100719943-100719965 CCTCCCCTGCTGAATGTGGCTGG + Intronic
1087829868 11:102807989-102808011 CCTCCACGGCGGAAGGTGGCAGG + Intergenic
1089026300 11:115274082-115274104 CTTTACCTGCAGAAGTTGGCTGG - Intronic
1090245134 11:125210739-125210761 CTTTCCCAGAAGTAGGAGGCGGG - Intronic
1090381005 11:126327890-126327912 CCCTCACAGCAGCAGGTGGATGG - Intronic
1092734267 12:11565323-11565345 GCCACACAGCAGAAGGTGGCAGG + Intergenic
1094720612 12:33059306-33059328 TCTTCCCAGCAAAAGGAAGCAGG + Intergenic
1096214873 12:49793257-49793279 CCGTCCCCGCAGCAGGTGCCAGG - Intronic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1103159149 12:118713130-118713152 CCTTCCCAGCCAATGGTGGCTGG - Intergenic
1103936426 12:124479921-124479943 TCTTCCCAGCCCAAGGAGGCTGG - Intronic
1106240591 13:27909490-27909512 CCTTCCCAGCAAATTGTGACAGG - Intergenic
1106278766 13:28243117-28243139 CCTAGCCAGCACAAGATGGCAGG - Intronic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1106469900 13:30045036-30045058 TCATCCCAGCAGAATGTGGAGGG - Intergenic
1106828452 13:33551247-33551269 ACTTCACAGCTGAAGGGGGCTGG + Intergenic
1107985594 13:45773575-45773597 TCTGCACAGCAGAAGATGGCAGG + Intergenic
1109605206 13:64685172-64685194 TCTGCCCAGCAGCATGTGGCAGG - Intergenic
1110689953 13:78421289-78421311 CCTTCCCAGGAGAAAGATGCCGG + Intergenic
1113756749 13:112817616-112817638 CCTTCCCTGCAGACTGTGGCTGG + Intronic
1113799953 13:113081095-113081117 CCTGCCCAGCAGGAGGGGACTGG - Intronic
1113900638 13:113794917-113794939 CCTTCCGTGCAGAAGGCGCCTGG + Intronic
1114035077 14:18616733-18616755 TCCTGCCAGCAGGAGGTGGCAGG - Intergenic
1114123568 14:19698283-19698305 TCCTGCCAGCAGGAGGTGGCAGG + Intergenic
1115440481 14:33429263-33429285 CCTTCCCAGGCGAATGTAGCTGG + Intronic
1115852382 14:37598558-37598580 ACTTCCCAGCAGGATCTGGCTGG + Intronic
1116798600 14:49418332-49418354 CCTTCCCAGGGGAAGGGGGTTGG + Intergenic
1122275656 14:100589465-100589487 CCTTCCTAGCTTAAGGGGGCTGG - Intergenic
1122393619 14:101407469-101407491 CCTTGCCTGGAGAAGGCGGCTGG - Intergenic
1122788996 14:104176544-104176566 CCCTGCCAGCAGAAGCTGCCTGG - Exonic
1123880867 15:24676552-24676574 CCTTCCAAGCAGGAGCTCGCTGG - Exonic
1124121419 15:26892275-26892297 CATTCCCAGCAGTGGGTAGCCGG + Intronic
1125461277 15:39909058-39909080 CCTTTGTAGCAGAAGGTAGCAGG - Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1128874958 15:71194366-71194388 GCTTCTCAGTAGCAGGTGGCTGG - Intronic
1129080352 15:73033842-73033864 ACTTCCTAGCATAAGGTGGAAGG + Intergenic
1129241873 15:74256753-74256775 CCTTCCCAGAAGAGGGTAGAAGG + Intronic
1129676252 15:77633602-77633624 CCTGTCCAGCAGAGGGCGGCAGG + Intronic
1130927113 15:88393981-88394003 CCTTCCCAACAAGAGGAGGCAGG + Intergenic
1131324839 15:91432235-91432257 TCTTCCCTGGAGAAGGTGGGTGG + Intergenic
1131999317 15:98163374-98163396 GCTTCTCAGCAGAAAGGGGCAGG - Intergenic
1132012475 15:98288162-98288184 CCATCCCTGGAGAAGGTAGCTGG + Intergenic
1132380993 15:101366658-101366680 AATTTCCTGCAGAAGGTGGCTGG + Intronic
1132504149 16:298349-298371 CCGTCCCAGCCCAGGGTGGCCGG + Intronic
1133236498 16:4389620-4389642 CCTTCCCACCAGGCTGTGGCCGG + Intronic
1133267338 16:4593119-4593141 CCTTCCCAGCAGGAGGAAGGAGG - Intronic
1133968971 16:10553485-10553507 CATGCCCAGGAGAAGGTGCCGGG - Intronic
1134006682 16:10822712-10822734 TCTTCCCAGCAGAACAGGGCTGG + Intergenic
1136597688 16:31262819-31262841 CCTTTCCAGAAGAAGGGGGCTGG + Intronic
1137712679 16:50577223-50577245 CCTTCCCAGCGGAGGGTTGTTGG + Intronic
1138146946 16:54621230-54621252 CCTACCCAGCCAGAGGTGGCTGG - Intergenic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1139307773 16:66002283-66002305 CCTTCCTAATAGAAGGTGGAAGG + Intergenic
1142158177 16:88542469-88542491 CCTTCCCAGCAGATGGCAGGAGG - Intergenic
1142473385 17:175883-175905 CCTTCCCAGGAGGTGGTGACGGG - Intronic
1144108373 17:12007667-12007689 CATCCCCAGCAGCAGGTAGCAGG - Intergenic
1144339211 17:14298578-14298600 CCTTCCCGGCACAAGGTCGGAGG - Intergenic
1146162048 17:30565337-30565359 CCTTCCCAGCCTGAGTTGGCTGG - Intergenic
1147318376 17:39631903-39631925 CCTACCCAGCCCAAGGTGGGAGG - Intronic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1147651928 17:42067745-42067767 CTCTCCCAGCAGGAGGAGGCAGG + Intergenic
1148195453 17:45709685-45709707 CTTTCCCAGCAGATGGTAGCTGG + Intergenic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1152111100 17:78358249-78358271 CTCTCCCTGCAGAATGTGGCAGG - Exonic
1152421686 17:80196764-80196786 GCTTCCCAGCTGGTGGTGGCAGG - Intronic
1152647244 17:81475092-81475114 TGTTACCAGGAGAAGGTGGCAGG - Intergenic
1153293194 18:3521370-3521392 CCTGCCCTGCTGAAGGGGGCTGG - Intronic
1153978744 18:10291585-10291607 CCTATCCAGCAGAATGAGGCCGG - Intergenic
1156867860 18:41908674-41908696 TCATCCCATCAGAAGGTGGAGGG - Intergenic
1157161118 18:45315375-45315397 CTTACCCAGCAGAAGGAGGGTGG + Intronic
1157532260 18:48430802-48430824 CCTTCCAAGAGGAAGATGGCAGG + Intergenic
1159898779 18:74022611-74022633 CCTTCCCAGGGGAATGTGACAGG - Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1161331000 19:3687820-3687842 CTTTCCCCGCAGCAGGTGGGCGG + Intronic
1161457098 19:4374946-4374968 CTGTCCCAGCACATGGTGGCAGG + Intronic
1161481648 19:4513691-4513713 CTTTCTCAGCAGATGGTGTCCGG - Exonic
1161852786 19:6746237-6746259 CCTGCCCAGCGGCGGGTGGCGGG + Intronic
1163701673 19:18789537-18789559 CATCCCCAGCAGAGGGGGGCAGG + Intronic
1164158036 19:22608222-22608244 CCTGCCCCGCAGGAGGGGGCTGG - Intergenic
1164699621 19:30275355-30275377 ACTCCCCAGCAAAAGGTGGGTGG - Intronic
1164832286 19:31331909-31331931 CCTGCCCAGAAGAAAGTGCCCGG - Intronic
1165816378 19:38645006-38645028 CTTTCCCAGGAGAAGCTGGAGGG - Intergenic
1166770709 19:45280452-45280474 CCTGCCCAGCAGGAGGTAGGTGG - Exonic
1167084003 19:47296694-47296716 CCTTCCGAGTAGATGGTGTCAGG + Intronic
1168333863 19:55585918-55585940 CCTTCCCAGCCGGAGGTCGAGGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925812948 2:7718962-7718984 CCTTCCCATCAGAAGCTAACAGG - Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
927945719 2:27134164-27134186 TCTTCCCAACAGAAGTGGGCAGG + Intronic
931164662 2:59733563-59733585 CAGTCCCAGCAGAAAGTGGACGG + Intergenic
932084272 2:68744302-68744324 CCTTCCCAGGACAAGCTGGGTGG - Intronic
935102455 2:100009912-100009934 CTTTCCCAGCAGAAGCAGGTGGG + Intronic
936092714 2:109511509-109511531 CCTGCCCACCTGAAGGTGCCTGG + Intergenic
937990331 2:127658688-127658710 CCTTCCTAGCAAAAGGTGTGGGG - Intronic
938194689 2:129316676-129316698 CCTTGCCAGCACAATATGGCAGG + Intergenic
938236453 2:129710148-129710170 ACTGCCCAGCAGTAGGTGCCAGG + Intergenic
938276176 2:130026120-130026142 TCTTGCCAGCAGGAGGTGGCAGG + Intergenic
938362804 2:130704601-130704623 TCCTGCCAGCAGGAGGTGGCAGG - Intergenic
938439192 2:131311214-131311236 TCCTGCCAGCAGGAGGTGGCAGG - Intronic
938776268 2:134544165-134544187 CCCTCGCAGCTGATGGTGGCAGG + Intronic
939086178 2:137721155-137721177 TCTTCCCAGAAAAAGGTGGAAGG - Intergenic
946445620 2:219737635-219737657 CATGCCCTGCAGAAGTTGGCTGG + Intergenic
947634069 2:231671349-231671371 GTGTCCCAGCAGAAGGTGGCCGG + Intergenic
947841565 2:233211091-233211113 CATTCCCTGCAGAATGAGGCAGG - Intronic
948598904 2:239097035-239097057 CCCTCCTAGCAGATGGGGGCCGG - Intronic
948893997 2:240919846-240919868 CCCTCCCAGGAGATGGGGGCAGG + Intronic
948953204 2:241268528-241268550 CCATACCAGCAAAAGCTGGCAGG - Exonic
948980536 2:241492210-241492232 CCTGCCCAGCCGATTGTGGCTGG - Intronic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1169270452 20:4195357-4195379 GCTTCCCTGCAGACAGTGGCAGG + Intergenic
1171202023 20:23249784-23249806 TCTGCTCAGCAGAAGGTGGTGGG + Intergenic
1172097410 20:32467195-32467217 CCATCCAAGGAGAAGGTGCCAGG - Intronic
1172153535 20:32807815-32807837 CCTTCCCAGCAGCTTCTGGCGGG - Exonic
1172373977 20:34420959-34420981 CCTTGCCAGCCTAATGTGGCAGG + Intronic
1172402039 20:34659008-34659030 ACTTCCCAGTAGGGGGTGGCCGG - Intronic
1174395097 20:50242508-50242530 CTTTCCCTCCAGAAGGTGGGTGG + Intergenic
1174398028 20:50259976-50259998 GCTCCACAGCAGAAGCTGGCTGG - Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175185820 20:57179154-57179176 CTGTCCCAGCAGAAAGTGGCCGG + Intronic
1175985318 20:62761530-62761552 CAGTCCCAGGAGAAGCTGGCCGG + Exonic
1176185073 20:63773848-63773870 CCTTTCCAGGAGGCGGTGGCAGG - Intronic
1176415276 21:6471137-6471159 CCTTCCCAGTACAATGTGGTGGG - Intergenic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179295081 21:40054506-40054528 CCTTCCCGGCAGGAGGCAGCTGG + Intronic
1179413821 21:41182045-41182067 GTTTCCCAGGAGGAGGTGGCTGG + Intronic
1179690776 21:43079470-43079492 CCTTCCCAGTACAATGTGGTGGG - Intergenic
1180459197 22:15543779-15543801 TCCTGCCAGCAGGAGGTGGCAGG - Intergenic
1182351753 22:29703655-29703677 TCTTCCCCTCAGAAGGTGGTGGG + Intergenic
1183479566 22:38056164-38056186 CCTTGCCTGCACAATGTGGCTGG + Intergenic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184355655 22:43977860-43977882 CCTTCCCTGCAGGAACTGGCAGG + Exonic
1185041094 22:48504827-48504849 CCTTGCCAGCAGCAGCTGCCAGG + Intronic
950285461 3:11741306-11741328 CCCACACAGCAGAAGGTGGAAGG + Intergenic
950497938 3:13345418-13345440 ACTTCCCAGGAGAATGGGGCTGG + Intronic
952354174 3:32570083-32570105 CCTTCCCAGGGGAAGCTGTCAGG + Intronic
953013841 3:39053320-39053342 TAATCCCAGCAGAAGGTGGTAGG + Intronic
953071939 3:39529651-39529673 CTTTCCCCGAAGGAGGTGGCAGG + Intergenic
953083019 3:39638728-39638750 CCTTCCCAGAGGTAGGTGGGTGG + Intergenic
953835946 3:46344294-46344316 TTTTCCCAGCAGAATGTGGTAGG + Intergenic
953983454 3:47424364-47424386 CCTTCCCAGGAGAAGACTGCTGG + Intronic
955202131 3:56861005-56861027 CTTTCCCTGCAGCAGGGGGCTGG - Intronic
956698333 3:71937326-71937348 AATTCCCATCAGATGGTGGCTGG + Intergenic
958676873 3:97276882-97276904 CCTGCCCAGCAATTGGTGGCTGG - Intronic
959710365 3:109379713-109379735 TCTTCTCACCAGAAGATGGCTGG - Intergenic
960064074 3:113351991-113352013 CCTACCCAGCAGGAAGTAGCTGG + Intronic
961054886 3:123779443-123779465 GCTTCCCAGCATTTGGTGGCCGG + Intronic
961361045 3:126367354-126367376 CCTCCCCAGCTGAATCTGGCTGG + Intergenic
961435074 3:126911358-126911380 CCTTCCCAGGAGATGGAGTCTGG + Intronic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
961639135 3:128353904-128353926 CTTTCCCAGCAGCAGGTGAGCGG - Intronic
961745598 3:129061897-129061919 GTTGGCCAGCAGAAGGTGGCGGG - Exonic
963048868 3:141125335-141125357 GCTCACCAGCACAAGGTGGCAGG + Intronic
964442868 3:156729811-156729833 CCTTCTCAGGACAAGGTGTCTGG + Intergenic
966327118 3:178769377-178769399 CCACCCCAGCAGAGGGTTGCTGG - Intronic
971066678 4:23040725-23040747 CCTACCCAGCAGAAAGTAGATGG - Intergenic
979260103 4:118637053-118637075 CTTTTGCACCAGAAGGTGGCAGG + Intergenic
982312890 4:154004071-154004093 CCTCCTCAGCAGATGGTGCCAGG + Intergenic
982578917 4:157153560-157153582 CCCTCCCAGCAGTGAGTGGCAGG + Intronic
983497628 4:168461109-168461131 CCTTCCCAGAGGTTGGTGGCTGG + Intronic
983673062 4:170260235-170260257 CCCTCCCAGCGAGAGGTGGCTGG + Intergenic
987910628 5:24139368-24139390 CCTCCACAGCAGAAGGTGAGGGG - Intronic
989425432 5:41290788-41290810 GCTTCTCAGCAGAAAGAGGCGGG - Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
991543231 5:67752443-67752465 CCTGCCCTGGTGAAGGTGGCAGG - Intergenic
991944214 5:71883830-71883852 CCTTCCCAGCTGAAGATCACTGG - Intergenic
992956156 5:81910664-81910686 ACTTCCCTGCAGAGAGTGGCAGG - Intergenic
996093959 5:119378775-119378797 CCTTTAAAGCAAAAGGTGGCTGG + Intronic
996496292 5:124161100-124161122 CCTTCTCACCAGAAAGTGGCTGG + Intergenic
996924286 5:128805373-128805395 CCTTCCAAACAGAAAGTGCCAGG - Intronic
999644050 5:153700649-153700671 CCTTCCCTGCACAAGGCAGCTGG - Intronic
1000120936 5:158197220-158197242 CCTGCCCAGCAGCAGCGGGCTGG - Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1002813387 6:656515-656537 GCTTCCCAGGAGAGTGTGGCGGG - Exonic
1003281385 6:4695361-4695383 CCTTCCCACCAAAAGGTACCAGG - Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1007221420 6:40281973-40281995 CCTCCCCAGGAAAAGGTGTCTGG - Intergenic
1007591014 6:43021008-43021030 CCTTCCCAGCAGAACCTGGCTGG - Exonic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010877121 6:81120554-81120576 GCTGCACAGCAGGAGGTGGCTGG + Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1012237916 6:96838772-96838794 CTTTCACAGCTGTAGGTGGCAGG - Intergenic
1013079779 6:106802039-106802061 CCTTCCCAGCAGAAGGCAGGAGG - Intergenic
1013435177 6:110097580-110097602 CCTTCCCAGGAGAATGAGACAGG - Intergenic
1016840269 6:148518314-148518336 CATGCCCAGCAGACGGTGGTGGG - Intronic
1018901064 6:168051947-168051969 GCTGCCCAGCAGAAGGTGGTGGG - Intergenic
1019599491 7:1874153-1874175 GCTGCCCAGCAGACAGTGGCTGG + Intronic
1019788001 7:2991500-2991522 CCTTCCCACCAGAAGCTGTTGGG - Intronic
1019792790 7:3028046-3028068 ACTTCCCAGGAGAAGGGTGCTGG + Intronic
1022506590 7:30911626-30911648 CCTGCCCAGCCCAAGGAGGCAGG - Intergenic
1023355769 7:39365938-39365960 CCTACACAGCTGAATGTGGCTGG - Intronic
1024311585 7:47974512-47974534 CCCTCCCTGCAGAACGAGGCTGG - Intronic
1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG + Intergenic
1028550557 7:92057721-92057743 CCTTCAAAGCAGAACCTGGCAGG - Intronic
1029507007 7:100968705-100968727 CCATCCTTGCAAAAGGTGGCTGG - Intergenic
1033279603 7:139996352-139996374 GCTTCCCAGGGGAAGGTGGCAGG - Intronic
1033609052 7:142947950-142947972 CTTGTCCAGCAGAATGTGGCTGG - Intronic
1034634515 7:152556338-152556360 GGATCCCAACAGAAGGTGGCGGG - Intergenic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1036607062 8:10316886-10316908 ACTTTCCAGCAGAAGGTAGGAGG + Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037336799 8:17800718-17800740 CCTTCTCAGCAGAAGCAAGCGGG - Intronic
1037804960 8:22053973-22053995 CCTTCCCAGGGGGAGGAGGCCGG + Intronic
1044784311 8:95778454-95778476 CCATCCCAGCAGTCTGTGGCAGG + Intergenic
1045692813 8:104776961-104776983 TCTTCTCACCAGAAGGTGTCAGG - Intronic
1046969988 8:120212136-120212158 GCTCCCCAGGAGAAGGTGGGTGG - Intronic
1047223577 8:122938344-122938366 CCTTCCCAGCTGCAGGTGGCTGG - Intronic
1049266809 8:141671936-141671958 CCCTCCCAGGAGAGGGAGGCAGG - Intergenic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1052796351 9:32927056-32927078 CCTTCCCTGAAAAAGCTGGCAGG + Intergenic
1056595936 9:88007563-88007585 CCTTCCCAGCAGGAGGGGCTGGG - Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1059489769 9:114657575-114657597 ATGTCCCAGCAGGAGGTGGCCGG + Intergenic
1060406832 9:123376982-123377004 CCAAGCCAGCAGGAGGTGGCTGG + Exonic
1060536404 9:124392487-124392509 CCTTCCCCGCACAAGAGGGCAGG + Intronic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1060778146 9:126391845-126391867 CCTTCTCAGCAGGGGGTGTCTGG + Intronic
1060950057 9:127595836-127595858 CCTTCCCATCAGGAAGTGGTGGG - Intergenic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061377301 9:130234136-130234158 CCTCCCCAGCCCAAGGAGGCGGG - Exonic
1061803829 9:133127408-133127430 CCTGCCCAACAGGAGGTGACAGG - Intronic
1062600392 9:137316486-137316508 CGGTCCCGGCAGCAGGTGGCAGG + Intronic
1186981719 X:14964201-14964223 CCTTCCCAGAAGTCTGTGGCTGG - Intergenic
1187052300 X:15707136-15707158 CCTTCTCAGCATATGGTGTCAGG - Intronic
1189182380 X:39016485-39016507 CCTGCTCAGAAGATGGTGGCAGG + Intergenic
1189347426 X:40252618-40252640 CCACCCCAGCAGAAGAGGGCTGG + Intergenic
1196420458 X:115515522-115515544 CCTTCTCACCAGCAGGTGGATGG + Intergenic
1198567143 X:137916364-137916386 CCTACCCAGCAGGTGGTGGCAGG + Intergenic
1200073359 X:153539593-153539615 CCGTCCCTGCAGCAGATGGCAGG + Intronic