ID: 1001746841

View in Genome Browser
Species Human (GRCh38)
Location 5:174098864-174098886
Sequence CTAGTTCTCCAGCGCTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001746841_1001746842 -4 Left 1001746841 5:174098864-174098886 CCAATGTAGCGCTGGAGAACTAG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1001746841_1001746844 30 Left 1001746841 5:174098864-174098886 CCAATGTAGCGCTGGAGAACTAG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1001746844 5:174098917-174098939 AAATTCAAGAAGTGAAACCAAGG 0: 1
1: 0
2: 1
3: 37
4: 385
1001746841_1001746843 2 Left 1001746841 5:174098864-174098886 CCAATGTAGCGCTGGAGAACTAG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1001746843 5:174098889-174098911 AGCTGTTTATCGCGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001746841 Original CRISPR CTAGTTCTCCAGCGCTACAT TGG (reversed) Intronic
901059280 1:6464694-6464716 ACAGTTCTCCAGCGCCACCTGGG + Exonic
903503909 1:23819278-23819300 CAAGTTCTCAAGGGCCACATGGG + Intronic
909784385 1:79592809-79592831 TTATTTCTCCAGCTCTATATTGG + Intergenic
914967268 1:152271139-152271161 ATAGTTCTGCAGGGCAACATAGG + Intergenic
914969100 1:152290974-152290996 ATAGTTCTGCAGGGCAACATAGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915871186 1:159561226-159561248 ATTGTTCTCCAGGGCTTCATTGG - Intergenic
916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG + Exonic
922510125 1:226158759-226158781 CTGGTTCTGCAGAGCTAGATTGG - Intronic
1069041361 10:63699029-63699051 CTATTTCCCCATTGCTACATTGG - Intergenic
1079471522 11:20782657-20782679 TTATTTCTCCAGGACTACATGGG - Intronic
1089684936 11:120140733-120140755 CTAGTCCTCCAGCGATGCGTTGG - Intronic
1090105478 11:123850628-123850650 CTAGTTCTCCAGCAATAAATTGG - Intergenic
1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG + Intergenic
1104399831 12:128466150-128466172 CTAGTTCTCCATCGCAGCAGCGG - Intronic
1104445373 12:128828821-128828843 CAGGTTCTCCTGAGCTACATGGG - Intergenic
1130221957 15:82027068-82027090 CTAGTACTCCAGAGCTCCAGAGG + Intergenic
1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG + Exonic
1150122438 17:62615505-62615527 CTAGTTCTCCAGCTTCACACAGG + Intergenic
1152684964 17:81689419-81689441 CTAGTTCTCCACGGCCACAATGG - Intronic
940202475 2:151166788-151166810 CCAGGTCTCCAGCGCTGGATAGG - Intergenic
940451836 2:153847910-153847932 TTAGTTCTAGAGCGCTCCATGGG - Intergenic
947897092 2:233685460-233685482 CCAGTTCTCCAGAGCTGCACTGG - Intronic
1182173861 22:28262782-28262804 CTAGTTCTCCATTTCTACTTGGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
957513054 3:81214756-81214778 CTAGTTCTCCATCAATACTTTGG + Intergenic
961123179 3:124391561-124391583 CATGTTCTTCAGCGCTAAATCGG + Intronic
962678763 3:137777053-137777075 CTTGTTCTCCTGCGCTTAATCGG + Intergenic
965485623 3:169274756-169274778 CTAGTGCTCAATAGCTACATAGG + Intronic
966867821 3:184270230-184270252 CTATTTCTCCAGCCCTGAATGGG + Intronic
982206240 4:152999184-152999206 CTGGTTCTCCAGGGCTAAACTGG - Intergenic
995354065 5:111217581-111217603 GTAGTTCTCCAGGGCTAAAGTGG - Intergenic
1001431863 5:171668258-171668280 CCAGTTCTCCAGGTCTACACTGG - Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1005116181 6:22340089-22340111 CAAATTGTCCAGAGCTACATGGG - Intergenic
1014988829 6:128048441-128048463 CTAATGCTCCTGCCCTACATGGG + Intronic
1018478574 6:164167758-164167780 ATACTTCTCCAGCACTGCATGGG + Intergenic
1021811566 7:24406851-24406873 CTAGCTCTCCAGCACTACACTGG - Intergenic
1022214275 7:28242937-28242959 TTAGTGCTCCAGCACTATATGGG - Intergenic
1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG + Intronic
1036698429 8:10994380-10994402 CAAGCCCTCCAGCGCTGCATGGG - Intronic
1041519887 8:58744123-58744145 CTAGTTCTGCTGTGCAACATAGG + Intergenic
1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG + Intronic
1049820503 8:144630394-144630416 CTGGTTCTCCAGCCCTACGGTGG + Intergenic
1053346702 9:37383472-37383494 CTGGTTATCCAGAGCTACCTAGG + Intergenic
1061918020 9:133767008-133767030 CTACTTCCCCTGCCCTACATTGG - Intronic
1192286457 X:69743278-69743300 CAATTTCTCCAGTGATACATGGG - Intronic
1195830111 X:109047654-109047676 CTAGTTCTCAAGAACAACATAGG - Intergenic
1195861800 X:109391012-109391034 CTCATTCTCCAGCTCTACTTTGG + Intronic
1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG + Intergenic