ID: 1001746842

View in Genome Browser
Species Human (GRCh38)
Location 5:174098883-174098905
Sequence CTAGCGAGCTGTTTATCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 7}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001746840_1001746842 -1 Left 1001746840 5:174098861-174098883 CCTCCAATGTAGCGCTGGAGAAC 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1001746841_1001746842 -4 Left 1001746841 5:174098864-174098886 CCAATGTAGCGCTGGAGAACTAG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1001746836_1001746842 29 Left 1001746836 5:174098831-174098853 CCGTGGTGAGGACTGTGCCTGTA 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1001746837_1001746842 12 Left 1001746837 5:174098848-174098870 CCTGTAATGAAACCCTCCAATGT 0: 1
1: 0
2: 1
3: 2
4: 108
Right 1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1001746839_1001746842 0 Left 1001746839 5:174098860-174098882 CCCTCCAATGTAGCGCTGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001746842 Original CRISPR CTAGCGAGCTGTTTATCGCG AGG Intronic
904253665 1:29241089-29241111 CTAGCCATCTGGTTATCGTGTGG + Intronic
908623638 1:66014823-66014845 TTAGGGAGCTGTTTATTGCAGGG - Intronic
918918095 1:190670880-190670902 CTAGCTAGCTGATCATCCCGAGG + Intergenic
938755166 2:134372751-134372773 CTAGCCAGTTGCTTATTGCGTGG + Intronic
951102894 3:18709859-18709881 GTAGCCAGCTGTTTATCTCTAGG + Intergenic
1001746842 5:174098883-174098905 CTAGCGAGCTGTTTATCGCGAGG + Intronic
1009749267 6:67862190-67862212 CTAGAGAGCTGTCTATAGCCTGG - Intergenic
1038254116 8:25935003-25935025 CTTGCAAGCTGTTTCTCGCCAGG + Intronic