ID: 1001746843

View in Genome Browser
Species Human (GRCh38)
Location 5:174098889-174098911
Sequence AGCTGTTTATCGCGAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001746839_1001746843 6 Left 1001746839 5:174098860-174098882 CCCTCCAATGTAGCGCTGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1001746843 5:174098889-174098911 AGCTGTTTATCGCGAGGCTCAGG No data
1001746837_1001746843 18 Left 1001746837 5:174098848-174098870 CCTGTAATGAAACCCTCCAATGT 0: 1
1: 0
2: 1
3: 2
4: 108
Right 1001746843 5:174098889-174098911 AGCTGTTTATCGCGAGGCTCAGG No data
1001746841_1001746843 2 Left 1001746841 5:174098864-174098886 CCAATGTAGCGCTGGAGAACTAG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1001746843 5:174098889-174098911 AGCTGTTTATCGCGAGGCTCAGG No data
1001746840_1001746843 5 Left 1001746840 5:174098861-174098883 CCTCCAATGTAGCGCTGGAGAAC 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1001746843 5:174098889-174098911 AGCTGTTTATCGCGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001746843 Original CRISPR AGCTGTTTATCGCGAGGCTC AGG Intronic
No off target data available for this crispr