ID: 1001746844

View in Genome Browser
Species Human (GRCh38)
Location 5:174098917-174098939
Sequence AAATTCAAGAAGTGAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001746841_1001746844 30 Left 1001746841 5:174098864-174098886 CCAATGTAGCGCTGGAGAACTAG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1001746844 5:174098917-174098939 AAATTCAAGAAGTGAAACCAAGG 0: 1
1: 0
2: 1
3: 37
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001746844 Original CRISPR AAATTCAAGAAGTGAAACCA AGG Intronic
900790625 1:4677597-4677619 AAATTTAACATCTGAAACCAAGG + Intronic
902538840 1:17138163-17138185 AAAGTCAAGAAAGGAAAACAAGG - Intergenic
902915717 1:19637971-19637993 AGAATCAAGAAGGGAAATCAAGG - Intronic
904550272 1:31310858-31310880 CAAATCAAGAAGAGAAATCAAGG - Intronic
904682068 1:32236071-32236093 AACCTCAGAAAGTGAAACCATGG - Intergenic
904937474 1:34141798-34141820 GAATGCAAGGAGGGAAACCAGGG + Intronic
907099952 1:51822082-51822104 AAATATAAGAAGTGAATCAAAGG - Intronic
907369137 1:53987931-53987953 AACCTCAGAAAGTGAAACCATGG - Intergenic
907846641 1:58214428-58214450 AGATTCAAAAAGATAAACCAGGG + Intronic
908039697 1:60097260-60097282 TAATTCAAGAAGTAAAAGGAAGG - Intergenic
908092828 1:60704578-60704600 AAATTAGAGAAAAGAAACCAAGG + Intergenic
908478659 1:64514500-64514522 AAAACCTAGAAGTGAAACCTAGG - Intronic
908827368 1:68146625-68146647 AAAGTCTTAAAGTGAAACCAGGG + Intronic
909250549 1:73348556-73348578 GAATTCAATAAGAGAAACTATGG + Intergenic
909394643 1:75156058-75156080 AAATACCAGTAGTAAAACCAAGG + Intronic
911326184 1:96472245-96472267 TAAGTCAAGATTTGAAACCAAGG + Intergenic
911662085 1:100512068-100512090 AAAATCAAGCAGAGAAACAAGGG - Intronic
912173283 1:107126727-107126749 AATTTTAAGAAGTGAAAAAAAGG + Intergenic
914774018 1:150719455-150719477 AAATACAAGAAATCATACCATGG + Exonic
915812359 1:158927226-158927248 AAATGTATGAAGTGAAACAATGG - Intergenic
916367089 1:164042009-164042031 AAATTCCAGAAATGAAAACTGGG - Intergenic
917286478 1:173426579-173426601 AAATTTAAAAAATGAACCCATGG - Intergenic
917621404 1:176800242-176800264 TAATTTAAGAAGTTAAACAAAGG - Intronic
917990272 1:180368887-180368909 AACTGCAGAAAGTGAAACCATGG + Intronic
918006024 1:180543040-180543062 AAATTCAGGAACTGAGGCCAAGG - Intergenic
918061203 1:181062611-181062633 AAAATAAGGAAGTGAAACCAAGG + Intergenic
919556619 1:199063206-199063228 GAATTCATGTAGTGAAATCAAGG + Intergenic
920191979 1:204199450-204199472 AGAGCCAAGAAGTGAACCCAAGG - Intronic
920675612 1:208036531-208036553 GAATTAAAGAAGTTAAAACACGG + Intronic
923247530 1:232147051-232147073 CAATTGAAGAAGTGAAAGGAAGG + Intergenic
924478830 1:244407766-244407788 AAATTCAAGGAGTAAAATCATGG - Intergenic
1062777760 10:168576-168598 ACATTCAAAAAGTGATTCCATGG + Intronic
1063231257 10:4067681-4067703 GGATTCTAGAAGTGAAACAAAGG - Intergenic
1063401489 10:5750474-5750496 AAATTTAAGTAATGGAACCATGG + Intronic
1063886754 10:10587805-10587827 AAATTCAAGAGGAGAAATGAGGG + Intergenic
1064489510 10:15836865-15836887 AAAATCAAGAAATGGAATCAAGG + Intronic
1065469692 10:26065007-26065029 AACTTCAAGAACTGAAACTTGGG + Intronic
1066447463 10:35496686-35496708 AAATGGAAGAGGAGAAACCAAGG + Intronic
1067894386 10:50163248-50163270 AATTTGAAGAATTGAAGCCAGGG + Intergenic
1067954454 10:50777013-50777035 AATTTGAAGAATTGAAGCCAGGG - Intronic
1068817670 10:61335915-61335937 AAATTCAGAAAGTGACACCAGGG - Intergenic
1069356192 10:67588319-67588341 AAATTCAAAAATAGAAACAACGG - Intronic
1069362798 10:67662393-67662415 AACTGCTAAAAGTGAAACCATGG + Intronic
1069507060 10:69009200-69009222 AAATTCAAGAAATGTAACATTGG + Intronic
1071880576 10:89892772-89892794 AAATTCTAGAAGAAAAACTAGGG - Intergenic
1073870943 10:107863570-107863592 AAAATCAAGAGTTGAACCCAGGG + Intergenic
1075128407 10:119719561-119719583 AAAGTAAAGAAGTGAAAAAAGGG + Intergenic
1075403165 10:122175508-122175530 AAATGCAATATGTGAACCCAAGG - Intronic
1076179587 10:128396698-128396720 AAATTGAACAAGTGTATCCAAGG + Intergenic
1076420650 10:130329285-130329307 AAATTCAACAAGTGACATCATGG + Intergenic
1076617377 10:131764871-131764893 AAACACAAGGAGTGAAACCGAGG + Intergenic
1077532211 11:3102695-3102717 ACAATAAAGAAGTGGAACCACGG + Intronic
1078728571 11:13955230-13955252 AAATTCAAGAAGAGAACCCACGG - Intergenic
1079526184 11:21391391-21391413 AAGTCCCAGAAATGAAACCAGGG - Intronic
1080911114 11:36599917-36599939 AAATGCAAAAATAGAAACCATGG + Intronic
1081055608 11:38406879-38406901 AAATTCCTCATGTGAAACCATGG + Intergenic
1081061656 11:38486163-38486185 AATGTCAAGAAGTGAGACTACGG + Intergenic
1081200166 11:40205604-40205626 AACTTCAAGTAGTGAAAGGAGGG - Intronic
1081214750 11:40382280-40382302 AAATTAAAAAAGTAAAAACACGG - Intronic
1083976447 11:66125602-66125624 AGATTCAAGTAGAGTAACCAGGG + Intronic
1084701368 11:70788312-70788334 AACCTCAGAAAGTGAAACCATGG - Intronic
1085600504 11:77851885-77851907 AAATTCAAGAAGTTCAACAGAGG - Intronic
1085799269 11:79573386-79573408 AAATTCAAGAAAAGATACAAAGG - Intergenic
1086667155 11:89496463-89496485 AATTTCAAGAAGAAAAAACATGG + Intronic
1087637340 11:100717074-100717096 AAATTCAAAAAAGGAAACCACGG + Intronic
1087975529 11:104541250-104541272 AAATGCAAGAGGTTAATCCAGGG + Intergenic
1088024605 11:105162722-105162744 AAAAAAAAGAAGTGAAAACAGGG - Intergenic
1088360313 11:108982377-108982399 AATATCAAAAATTGAAACCAAGG + Intergenic
1088686373 11:112287508-112287530 AAAGTCAAGAAATGTAGCCAAGG - Intergenic
1088787062 11:113191523-113191545 AAAGCCAAGATGTGAACCCAGGG - Intronic
1089329753 11:117681045-117681067 AAATGCAAGATGAGAATCCAGGG - Intronic
1092679204 12:10958739-10958761 ATATTCAAGAAGTGACACAAAGG + Intronic
1092680872 12:10979431-10979453 ATATTCAAGAAGTGACACAAAGG + Intronic
1092804690 12:12209461-12209483 AACTACAATAAGTGAAACTAAGG + Intronic
1093228146 12:16510561-16510583 AAATTCAAAATGGAAAACCAAGG - Intronic
1093247058 12:16752467-16752489 AAAATCAATAAGTAAAACAATGG - Intergenic
1093805938 12:23433058-23433080 AAAAAGAAGAAGAGAAACCAGGG + Intergenic
1093844160 12:23948372-23948394 ACATTCTAGAAGTGAAGCAATGG - Intronic
1093907339 12:24708727-24708749 AAATTCAAGATTTGAACCCAGGG - Intergenic
1094302757 12:28984298-28984320 AAATACAAGAACTTAACCCAAGG - Intergenic
1098437522 12:70483753-70483775 AACTTCAAGAACTGTAACCCAGG - Intergenic
1099326670 12:81224627-81224649 AACTGCATGAAGTGAAACTACGG - Intronic
1099914305 12:88872979-88873001 AAAACCAAGGCGTGAAACCATGG + Intergenic
1100053411 12:90479232-90479254 AAATACTAGGAGTAAAACCATGG - Intergenic
1100420435 12:94427128-94427150 AAATCAAAGAAGTCTAACCATGG - Intronic
1100643551 12:96505751-96505773 AAAATAAAGAAGTGAGGCCAAGG - Intronic
1101184270 12:102257235-102257257 AACTGCAGAAAGTGAAACCATGG - Intergenic
1102912192 12:116725115-116725137 AACTTCAGAAAGTAAAACCATGG - Intronic
1104695239 12:130858576-130858598 GAATTTAAAAATTGAAACCACGG + Intergenic
1105270478 13:18870018-18870040 CAATACAGGAAGTGAGACCATGG + Intergenic
1106567333 13:30897758-30897780 AAAGTCAAGGGGTGAACCCAGGG - Intergenic
1106615918 13:31327544-31327566 CACTTCAGAAAGTGAAACCATGG + Intronic
1107120512 13:36790466-36790488 AATTTCATGAATTCAAACCAAGG + Intergenic
1107650253 13:42537750-42537772 AAATTAAAGAACTGACACCTAGG - Intergenic
1109000844 13:56802992-56803014 AAAATCAGGAAGTGAATCTAAGG + Intergenic
1109156130 13:58912353-58912375 AAAATCAAGAAGTGGAGTCAGGG - Intergenic
1109574064 13:64230270-64230292 AAGTGTAAGAAGTGAAAGCAAGG + Intergenic
1109932508 13:69234685-69234707 AAATACAAAAAGTGTAAGCATGG - Intergenic
1110519485 13:76457960-76457982 GAATTCATGAAATAAAACCATGG + Intergenic
1110802255 13:79712359-79712381 AAATTCAAAAGGTGAACCCTAGG + Intergenic
1110972152 13:81777762-81777784 GAATTCAAGAAGTCAAACTTTGG + Intergenic
1112155101 13:96808657-96808679 AAAATGCAGAAGTGAAAGCATGG + Intronic
1112423328 13:99273739-99273761 AAATTCAAGAAGAGAAATACAGG - Intronic
1112738896 13:102452134-102452156 AAAGTCATTAAGTCAAACCAAGG + Intergenic
1114953147 14:27782232-27782254 AAATCCAGAAAGTGAAACCCCGG - Intergenic
1116247600 14:42436101-42436123 GAATTCAAGAATTAAAGCCATGG + Intergenic
1116355091 14:43918039-43918061 TGATTCAAGAAATGAAACTATGG - Intergenic
1116887445 14:50234651-50234673 AAATTCAATAAGAAAAACAAAGG + Intergenic
1118789444 14:69076293-69076315 ATATCCAAGAATTGAAAGCACGG + Intronic
1119687467 14:76644088-76644110 AAATGCCAAACGTGAAACCAAGG + Intergenic
1119900521 14:78255644-78255666 AACTGTAAGACGTGAAACCAAGG + Intronic
1120583474 14:86282513-86282535 AAATTGAAGAAGGGGAAACAAGG - Intergenic
1123573902 15:21645831-21645853 AAATGCAAGAAGTGGAGGCAAGG - Intergenic
1123610519 15:22088416-22088438 AAATGCAAGAAGTGGAGGCAAGG - Intergenic
1124185508 15:27524434-27524456 AAATACAAAAAGTGAAAATATGG + Intronic
1125047510 15:35259187-35259209 GAATTCGAGAAGGGAAAGCAAGG - Intronic
1125124745 15:36207126-36207148 AAACACAGGAAGCGAAACCATGG + Intergenic
1125295293 15:38196292-38196314 AATTTCTAGGAGTGAAGCCAAGG - Intergenic
1125430935 15:39592854-39592876 AGATTGAAGAAATGAAACCAAGG + Intronic
1125798219 15:42420115-42420137 AACCTCAGAAAGTGAAACCATGG - Intronic
1125852245 15:42915084-42915106 AACTGCAGAAAGTGAAACCATGG - Intronic
1126011644 15:44308549-44308571 ACATAAAAGAAGTGAAACCAGGG - Intronic
1127506461 15:59602780-59602802 AAAGTAAAGAAATGAAAGCATGG + Intronic
1129687053 15:77692477-77692499 AAGTTCAAGAAGTAAAATAAAGG + Intronic
1129780813 15:78269632-78269654 AAATTCAAGAAGTTTAACATTGG + Intronic
1130775839 15:86981533-86981555 CAAGTCAAGGAGAGAAACCAAGG - Intronic
1202982767 15_KI270727v1_random:380171-380193 AAATGCAAGAAGTGGAGGCAAGG - Intergenic
1133587033 16:7205594-7205616 AGATTGTAGAAGTGAAAACAGGG - Intronic
1134280142 16:12809915-12809937 AAATAGAAGAAATGAAATCATGG - Intergenic
1135883363 16:26280813-26280835 GAAATCAAGAAATGAAAACATGG + Intergenic
1136273745 16:29165646-29165668 AAATGAAAGCAGTGAAATCAAGG - Intergenic
1136595696 16:31248326-31248348 AAATTTAAGAAAAGAAATCAAGG - Intergenic
1137327709 16:47458823-47458845 ACATTCAAGAAGGGATACGAGGG + Intronic
1139150790 16:64380221-64380243 AAAAACAATAAATGAAACCAGGG + Intergenic
1141355214 16:83339132-83339154 ACATTCAGGAAGTGAAACAATGG + Intronic
1142077287 16:88127391-88127413 AAATGAAAGCAGTGAAATCAAGG - Intergenic
1146459173 17:33031455-33031477 ATGTTTAAGAAATGAAACCATGG - Intronic
1147868899 17:43573340-43573362 AAACTCAAAAATTTAAACCAAGG - Intronic
1150137310 17:62703107-62703129 AAATGCCACAAGTGAAACCGAGG - Intronic
1150869980 17:68896384-68896406 AACTGCAGAAAGTGAAACCATGG - Intronic
1151823641 17:76511490-76511512 AGAATCAAGAAGTGAAATAAAGG + Intergenic
1151897221 17:76988538-76988560 AAGTTGAAGAAGGGAATCCAGGG - Intergenic
1153618117 18:6952561-6952583 AACCTCAAAAAGTGAAACCTTGG - Intronic
1153939065 18:9961566-9961588 AAATTCAAGATTTGGAACAAAGG + Intergenic
1155099063 18:22590512-22590534 ATATTAAAGAAGTGACAGCAAGG - Intergenic
1155335337 18:24758124-24758146 AAATTCAAAAAATAAACCCATGG - Intergenic
1155342901 18:24830863-24830885 AAATTAAAGTAGAGAAACTACGG + Intergenic
1156015167 18:32539206-32539228 AAAGTCAAGAAGGGAAGCCAAGG - Intergenic
1156721423 18:40074668-40074690 AAATTAAAGAAGTGAGACAAGGG + Intergenic
1158046459 18:53161473-53161495 AAAGTCAAGAAGTGAATGAAAGG - Intronic
1158090516 18:53706983-53707005 AAATTCAGCAAGAGAAACCATGG - Intergenic
1159105470 18:63998791-63998813 AAATTCAGGCACTGCAACCAGGG - Intronic
1159235157 18:65662013-65662035 AAATCTAAGAAGTGATATCAAGG + Intergenic
1159470022 18:68840646-68840668 TGCTTCAAGAAGTAAAACCACGG - Intronic
1159767528 18:72508497-72508519 AAATTCAAGATGTGATACTGAGG - Intergenic
1162148711 19:8629998-8630020 AAATTAAAGAAAAGAAAACAGGG + Intergenic
1162275257 19:9648633-9648655 AACTTGAAGAAGTGAATGCATGG - Intronic
1164522880 19:28992271-28992293 AAATTCAAGAATTCAGGCCAGGG - Intergenic
1166199587 19:41228057-41228079 AACCTCAAAAAGTGAAACCTCGG + Intronic
1168513782 19:56994021-56994043 AAGCTCAAGCTGTGAAACCAAGG - Intergenic
926082447 2:9999007-9999029 ATATTCAAGAAGTGTAAAAAGGG + Exonic
927227938 2:20788942-20788964 AAATGGAAGAAGTAATACCATGG - Intronic
927457667 2:23270905-23270927 ATATTCAAGAAGAGAGAGCAAGG - Intergenic
927582171 2:24261394-24261416 AAATTTAGTAAGTGAAAACATGG - Intronic
929336885 2:40759429-40759451 AAATTCAAGAGGGCAAAACAAGG - Intergenic
929724786 2:44413678-44413700 AAATTTAAGAAATGGATCCATGG + Intronic
929807037 2:45155275-45155297 AAATTCTAGAAGGCAAAGCAAGG + Intergenic
929852997 2:45610291-45610313 AAATTCAAGAAGGCAAACAAAGG + Intronic
930062076 2:47298445-47298467 AAATCCATAAAGTGAAAGCAAGG - Intergenic
930866742 2:56129429-56129451 AAATTTAAAATTTGAAACCATGG + Intergenic
930990126 2:57644222-57644244 AAATTGAATAATTGATACCATGG - Intergenic
930999597 2:57764506-57764528 AAATTCAAGGAGGGAATGCAAGG + Intergenic
931025184 2:58105103-58105125 AAATACTAGAAGTAAAACAAGGG + Intronic
931374022 2:61691786-61691808 AAATTTAAAAAGTTTAACCAAGG - Intergenic
931595726 2:63940834-63940856 GAATATAAGAAGTGAAAACATGG + Intronic
931965996 2:67535369-67535391 CAAAACAAGAAATGAAACCACGG + Intergenic
932335026 2:70925723-70925745 AAATTCAATAACAGGAACCATGG + Intronic
933821898 2:86120528-86120550 AAAGTCCAGAAGAGAAAGCAGGG - Intronic
934117531 2:88811213-88811235 AAATTGAAGAAGTGCCACCAAGG - Intergenic
934484181 2:94687202-94687224 AAATCCAGAAAGTGAAACCCCGG + Intergenic
934688252 2:96337159-96337181 AAAGGCAAGGAGAGAAACCACGG + Intronic
934782019 2:96976542-96976564 ATAGTCAAAAAGTGAAAACAGGG + Intronic
935338327 2:102036943-102036965 AAAGAAAAGAAGTCAAACCAGGG - Intergenic
935420168 2:102859247-102859269 ACAGTCTAGAAGTGAAACCCAGG - Intergenic
935584221 2:104785963-104785985 ACATTCACGATGGGAAACCAAGG - Intergenic
936346314 2:111677886-111677908 AATTTCAAGAAAGGAGACCATGG + Intergenic
936770586 2:115907961-115907983 AAATTCCAATAGTGTAACCATGG + Intergenic
937328772 2:121008843-121008865 AACTGCAGAAAGTGAAACCATGG + Intergenic
937725807 2:125165042-125165064 AGGTTCAAGAAGTTAAAGCATGG + Intergenic
939499887 2:142970667-142970689 AAATTCAAGTAGGCAAAACATGG - Intronic
940072246 2:149701747-149701769 AAATTAAAAAAGTGCATCCAAGG - Intergenic
940159526 2:150696543-150696565 AGAATCAAAAAGTGAAATCATGG + Intergenic
940685280 2:156841531-156841553 AAATGCAGAAAGTGAAACCACGG - Intergenic
941536287 2:166725792-166725814 AAATTTAAAAACTGACACCAAGG + Intergenic
942310997 2:174656611-174656633 AAAGTTAAGAAGTCCAACCAAGG + Intronic
942537820 2:176984047-176984069 AAATTCAAGCAGGAAAAACAGGG - Intergenic
942600088 2:177632171-177632193 AGAGTCAAGAAGAAAAACCAAGG + Intronic
943314742 2:186373118-186373140 CAATTCAACAATTAAAACCATGG + Intergenic
943532510 2:189101667-189101689 AACTTCATGAAGTGAAATGATGG + Intronic
944177398 2:196848245-196848267 AAATTCAGGAAGTCAAAGCTGGG + Intronic
944408942 2:199417581-199417603 AACTTTAAGAAGAAAAACCAAGG + Intronic
945125197 2:206501375-206501397 AAGTGCAAAAATTGAAACCAGGG - Intronic
945199891 2:207271181-207271203 AAATCCAAGCAGTGAAAACCTGG + Intergenic
945295062 2:208162235-208162257 AGATTCAAGAATTGAAATCACGG - Intronic
945958935 2:216111939-216111961 GAATTCAAGAAGAGAAAAGAAGG - Intronic
946930357 2:224664436-224664458 TAATTCTAAAACTGAAACCAGGG - Intergenic
947071948 2:226298389-226298411 ATATTCAAAAATTGAAAACAAGG + Intergenic
947201658 2:227619645-227619667 AAAAGCAAGAAATGAAATCAGGG + Intronic
948331948 2:237176182-237176204 TATTTCAAAATGTGAAACCATGG - Intergenic
948562216 2:238861724-238861746 AACTTCGAAAAGCGAAACCATGG - Intronic
948621459 2:239237661-239237683 ATATTCAAGAACGGAAACAAGGG + Intronic
948624172 2:239258125-239258147 AAATGCAAAAAGTGAAATTAAGG + Intronic
948731577 2:239967247-239967269 AAATTCATAACGAGAAACCAAGG - Intronic
1169680881 20:8212174-8212196 AAATTCAAGAATTGTCACAAGGG + Intronic
1173628649 20:44492805-44492827 AAATTCAAGACATGAAGCCAGGG - Exonic
1174622775 20:51889006-51889028 AATTTGAAAAAGTGAGACCAAGG - Intergenic
1176054616 20:63137593-63137615 ATAGTCAAGAAGTGGAAACAAGG - Intergenic
1177449082 21:21241680-21241702 AAATTAAATAACAGAAACCAAGG + Intronic
1177638637 21:23818057-23818079 AAATCAAAGAAGAGAAACCTGGG + Intergenic
1178250366 21:30998186-30998208 AAATTTAGGAAGTGAAAGAAGGG + Intergenic
1179274051 21:39875079-39875101 AACCTCAGAAAGTGAAACCAAGG + Intronic
1181517988 22:23427156-23427178 AAATTTAAGAAGGAAAACCTGGG + Intergenic
1184382511 22:44154411-44154433 AAATTGAAGAAATTAAACCAGGG - Intronic
949807039 3:7966801-7966823 AGATTCAAGAAGGCAAATCAAGG - Intergenic
950843742 3:15994080-15994102 ATATACAAGAATTGCAACCATGG - Intergenic
951087034 3:18524760-18524782 GCATGAAAGAAGTGAAACCAGGG - Intergenic
951331245 3:21371108-21371130 AAAATCACAAAGTGAAACCATGG - Intergenic
951666426 3:25129262-25129284 AAATTCAGAAAGAGAAATCATGG - Intergenic
951992478 3:28690967-28690989 CAAATCAAAAACTGAAACCATGG + Intergenic
952524226 3:34193303-34193325 AACTGCAGGAAGTGAAACCATGG - Intergenic
952847086 3:37696968-37696990 AAAATGAAAAATTGAAACCAGGG + Intronic
953533495 3:43759013-43759035 ACCTTCAACAATTGAAACCAAGG + Intergenic
953559668 3:43977141-43977163 AGAGTCAGAAAGTGAAACCATGG - Intergenic
953873737 3:46651168-46651190 AAATACATGAACTGAAAACAAGG + Intergenic
954235026 3:49250203-49250225 AAATCCAGGAAGAGAGACCAAGG + Intronic
955248147 3:57248567-57248589 TGATAAAAGAAGTGAAACCAGGG + Intronic
955916139 3:63910742-63910764 AAGTCCAAAAAGTGAAACCATGG - Intronic
956010448 3:64825529-64825551 CAAATCAAGAAGTGACCCCATGG + Intergenic
957401873 3:79725991-79726013 AATCTCAAGAAGTCAAATCATGG + Intronic
957728634 3:84102731-84102753 AAATTAAAGAAGTGTAATTATGG + Intergenic
958023108 3:88019857-88019879 AAATTTAAAAAGTGTAGCCAGGG + Intergenic
959523593 3:107349428-107349450 TATTTCAATAAGTGAAAACAAGG - Intergenic
959776685 3:110173057-110173079 AAATTAAAGATGGGAAACCTAGG - Intergenic
961544479 3:127622826-127622848 AAGTTCAAGAAGGGAAAACTTGG - Intergenic
961638775 3:128351570-128351592 AAATTGTAGAAGTGATACGAAGG - Intronic
962329277 3:134463448-134463470 AAATTAAAGAAAAGAAACCATGG - Intergenic
963289834 3:143476320-143476342 AAATTCAGGAAGAGAGACGAGGG - Intronic
963427475 3:145150099-145150121 AAATTTTAGAAGAGAAACAAGGG + Intergenic
963509345 3:146227556-146227578 AAATTCTAGAACTCACACCAGGG + Intronic
964108645 3:153066316-153066338 AAATTCAAGTTATGAAAACATGG - Intergenic
964291936 3:155191038-155191060 CAGTCCAGGAAGTGAAACCAGGG + Intergenic
964990466 3:162804679-162804701 AAATTCAGGAGGTTAAACAAAGG - Intergenic
965541815 3:169878859-169878881 AAATTCAAAAAGGTAATCCAGGG - Intergenic
966670317 3:182519012-182519034 ATCTGCAATAAGTGAAACCAAGG - Intergenic
966821864 3:183931204-183931226 AACTGCAGAAAGTGAAACCATGG + Intronic
967101236 3:186217465-186217487 AAATACAAACAGTGACACCATGG + Intronic
967139656 3:186544894-186544916 AAATTCAAGAAGTTAAACTTTGG - Intronic
967358450 3:188601351-188601373 AATTTTAAGAAATGAAACTATGG + Intronic
967451955 3:189634911-189634933 AAATTCTAGAAATGAAAGAATGG - Intronic
970385163 4:15548663-15548685 TAATTTAAGAGGTCAAACCAAGG + Intronic
970427286 4:15957051-15957073 ATATTCAATAAGCCAAACCAGGG - Intergenic
970929949 4:21498037-21498059 AAAGTCAAGATTTGAAGCCAGGG - Intronic
971042023 4:22764342-22764364 AACCACAGGAAGTGAAACCATGG - Intergenic
971184915 4:24365391-24365413 AAATTCCAAAATTGAAACAATGG + Intergenic
971610752 4:28723070-28723092 AAAAGCAAGAAGTGAAAGCAGGG + Intergenic
972317034 4:37936365-37936387 AAACACAAAAAGTGAAACCATGG + Intronic
974130590 4:57750363-57750385 AAACTATAGAAGAGAAACCATGG + Intergenic
975920832 4:79384984-79385006 AAATGCAAGAAATGAACACAAGG - Intergenic
976873350 4:89823247-89823269 AACTTCAGGTAGTGAAACAAAGG + Intronic
977376662 4:96213498-96213520 AAATTAAAGAAGTCAAAATATGG - Intergenic
977545965 4:98377722-98377744 AAATATAAGAACTGAAACTAAGG - Intronic
977739532 4:100461208-100461230 AAAGTCAAGAAGTGAACATATGG - Intronic
978057437 4:104289511-104289533 AAAGTCTAGAAATAAAACCAAGG + Intergenic
978070292 4:104458917-104458939 AAATTGGAGAAGGTAAACCATGG - Intergenic
979294095 4:119011125-119011147 TACTTCAAGAAGGGAAATCAGGG - Intronic
979949201 4:126871335-126871357 AAAAGCAGGAAGTAAAACCAAGG + Intergenic
980305517 4:131055608-131055630 AAATTAGAAAATTGAAACCATGG - Intergenic
980793714 4:137653857-137653879 ATATTCAAGAAGTAAAACTTTGG - Intergenic
981820752 4:148884598-148884620 AAAATCAAAAAGTGAAAAAAAGG - Intergenic
982993486 4:162310469-162310491 AAATTCAAAAAATGAATGCAGGG + Intergenic
983177535 4:164608631-164608653 AAATTCATAAACAGAAACCAGGG + Intergenic
983474492 4:168197025-168197047 CAATTTAAGAACTGAAAGCATGG + Intergenic
983801716 4:171938909-171938931 AAAACCAAGATGTGAAACCTTGG - Intronic
983847497 4:172538158-172538180 AACTTCAAGATTTCAAACCATGG + Intronic
984133390 4:175906104-175906126 AAATTCAATGAGTGAATCAATGG + Intronic
984398198 4:179227144-179227166 AAATCAAAGAAGGAAAACCAAGG - Intergenic
985842831 5:2321730-2321752 AAATTCAAAAATTGAAGCAAGGG - Intergenic
986376761 5:7140357-7140379 AAATTCTAGAAGTAATATCAAGG - Intergenic
987445625 5:18015319-18015341 AAATTTATGAAGTAAAAACAAGG - Intergenic
988651468 5:33156644-33156666 AAATTCTAGAAGAAAAACCTAGG - Intergenic
989411899 5:41129092-41129114 AAATTTAAAAAGAGAACCCATGG - Intergenic
989707202 5:44348977-44348999 ACATTAAAGAAGAGAAACCCTGG - Intronic
990539902 5:56761889-56761911 GAATATAAGAACTGAAACCATGG + Intergenic
990610218 5:57449358-57449380 AAATTAAAGAAGTGGAGACATGG - Intergenic
991018247 5:61954228-61954250 AAAATCAGGAGGTGGAACCAGGG - Intergenic
992255405 5:74915981-74916003 AACTTCATGCAGTGAAACTAGGG - Intergenic
993157883 5:84250160-84250182 GAATTCAAGAATTTAAAACAAGG + Intronic
993805435 5:92402451-92402473 AATGTAAAGAAGTGTAACCATGG + Intergenic
994512690 5:100725317-100725339 AAAATCAAGAAATGAAGCAATGG + Intergenic
994992587 5:107016106-107016128 AACTGCGGGAAGTGAAACCATGG + Intergenic
995167827 5:109067350-109067372 ATCTTCAAGAAGAGAAACTAAGG - Intronic
996000537 5:118356656-118356678 ATTTTAAAGTAGTGAAACCAAGG - Intergenic
996993284 5:129663267-129663289 AAAATCAAGAAGAGAAGTCAAGG - Intronic
997722486 5:136090477-136090499 GAAGTCAAGAAAAGAAACCATGG + Intergenic
1000726162 5:164773472-164773494 AAATTAAGGAAATGAAAACATGG - Intergenic
1001746844 5:174098917-174098939 AAATTCAAGAAGTGAAACCAAGG + Intronic
1002631542 5:180584163-180584185 CAATCAATGAAGTGAAACCAGGG + Intergenic
1002708008 5:181175918-181175940 AAGTTCATAAAGTGAAAGCAAGG + Intergenic
1004082819 6:12412336-12412358 AAATACTATAAATGAAACCATGG - Intergenic
1004088191 6:12472463-12472485 AAATGGGAGAAGTGAAAACAAGG - Intergenic
1004098990 6:12589111-12589133 AAATTCAAGAACAGAAAAAAAGG + Intergenic
1005123526 6:22418610-22418632 AAATCAAAGCAGAGAAACCAAGG - Intergenic
1009369826 6:62885088-62885110 TAATTCAAGAAGTATCACCATGG + Intergenic
1009676644 6:66832431-66832453 AAATGCAAAAAGTGATACCATGG - Intergenic
1009831723 6:68946088-68946110 AAATTCAAGAATGAAAACAACGG - Intronic
1010391024 6:75337583-75337605 AAATTCAAGAAGTGGATGCATGG + Intronic
1010841863 6:80655847-80655869 AAATTGGATAAGTGAAACCGTGG + Intergenic
1011464064 6:87637045-87637067 ACATATAAGAAGTGAAACCAAGG - Intronic
1011763975 6:90599126-90599148 AACTGCAGAAAGTGAAACCATGG - Intergenic
1011920143 6:92564417-92564439 AAATAAAAGAATTGAAACAAAGG + Intergenic
1012088285 6:94857615-94857637 AAATTCAAGAAATCAAATTAGGG - Intergenic
1012691436 6:102317900-102317922 AAATTCAAGAAGTGTGAAAATGG - Intergenic
1013105139 6:107020717-107020739 AAAATAAAGAAATGAAAACATGG + Intergenic
1013219218 6:108062458-108062480 AACTACAGCAAGTGAAACCATGG + Intronic
1013473078 6:110482882-110482904 TATTTCAAAAAGTGAAATCATGG + Intergenic
1013580262 6:111527114-111527136 CAAGTCAAGAAGAGAGACCACGG - Intergenic
1013845111 6:114440988-114441010 AAATACATAAAGTGAAACCCTGG - Intergenic
1014095030 6:117450539-117450561 AAAATCAAGGATTGAAGCCAGGG - Intronic
1015256119 6:131181235-131181257 AAATACAAAAAGTGAAACATGGG - Intronic
1015741839 6:136464306-136464328 AACCTCAGAAAGTGAAACCATGG - Intronic
1016253638 6:142077314-142077336 AAATTTAAAAAGTGAAGCAAGGG + Intronic
1016281247 6:142421620-142421642 AAATTCTAAAAGCAAAACCAAGG - Intronic
1016574954 6:145559367-145559389 ATAGTCAAGAAGTGAAAACTAGG - Intronic
1017092755 6:150775718-150775740 TAATTTAAGTAGTGAAATCATGG + Intronic
1017562682 6:155646700-155646722 GAAATCATGAAGTGGAACCATGG + Intergenic
1017888827 6:158622656-158622678 AACTGCAGAAAGTGAAACCATGG + Intronic
1021443446 7:20706693-20706715 AAATTTAAAAAGTAAAACAAGGG + Intronic
1022054685 7:26718196-26718218 AAATGAAAGAAATGAAAGCAAGG + Intronic
1022260720 7:28702261-28702283 AGCTTCAACAACTGAAACCATGG + Intronic
1022368896 7:29752045-29752067 AAATTAAGAAAGTGAAACCAAGG + Intergenic
1023246808 7:38213682-38213704 AAATTCGACAAATGAAACTATGG - Intronic
1024182776 7:46913773-46913795 AAATTCATGAAATGAAAATAAGG - Intergenic
1024219473 7:47276677-47276699 AGATTCAAGCAGGAAAACCAGGG + Exonic
1024533749 7:50413156-50413178 AATTTCAGGTAGTGAAACTAAGG + Intergenic
1024861475 7:53847584-53847606 ATATTCAAGAATTTAAACCTAGG + Intergenic
1026242685 7:68590749-68590771 AAAGAAAAGAAGTGAAAGCATGG + Intergenic
1026813916 7:73493949-73493971 AAATTCAAAAAGGTAAGCCAGGG + Intronic
1027880347 7:83827524-83827546 AAATTTAAGAAATAAAAACATGG + Intergenic
1028025837 7:85837665-85837687 AAAAGCAAGAAGTAAAACAAAGG - Intergenic
1028103718 7:86852389-86852411 AAATTCCAGAAGGGATAGCAAGG + Intronic
1028283609 7:88966402-88966424 AATTTCAAGAAGTGAGGCCCAGG - Intronic
1028837341 7:95389573-95389595 ATAATCAAGAAGTTACACCAGGG - Intronic
1028948326 7:96605747-96605769 AACTGCAAAAAGTGAAAGCACGG - Intronic
1030135973 7:106248548-106248570 CAATTTAAGAAGGGAAAACAAGG + Exonic
1030293164 7:107891719-107891741 CCATTCAAGAAGTGACCCCAGGG - Intronic
1030692308 7:112547824-112547846 AAATTCAAAAAGTGAAAAAAGGG + Intergenic
1031037651 7:116805626-116805648 AAATTTAAAAAGTAAAATCAAGG - Intergenic
1033755055 7:144391509-144391531 AAATGCCAGCAGTGAACCCAGGG + Intergenic
1037061707 8:14519936-14519958 AAATTTAATAATTTAAACCATGG - Intronic
1040921811 8:52629238-52629260 AAATACAAGAAGTTAAATAAAGG + Intronic
1041147652 8:54894779-54894801 AAATTTTAGAAAAGAAACCAAGG - Intergenic
1044410726 8:91879772-91879794 AACTGCAAAAAGTAAAACCATGG - Intergenic
1044773907 8:95667546-95667568 AAGTTCAAGAAGAGAAGACATGG + Intergenic
1046020261 8:108656418-108656440 AGATTCAAGAGGGAAAACCAGGG + Intronic
1046252189 8:111646568-111646590 GAAATCAGAAAGTGAAACCAAGG + Intergenic
1046630889 8:116622159-116622181 AAAATCAAGATGTCCAACCAAGG - Intergenic
1047218364 8:122897952-122897974 AAATTCATGAAGAGAAATCATGG + Intronic
1047250867 8:123181452-123181474 AAAGTAAAGAAATGAAAGCAAGG - Intronic
1047364205 8:124197424-124197446 AGATTCCAGAAATGTAACCAGGG - Intergenic
1047378608 8:124332411-124332433 AATTTGAAGAAGTAAAAGCAAGG - Intronic
1047716846 8:127603496-127603518 AGAGTAAAGAAATGAAACCATGG - Intergenic
1048079986 8:131116367-131116389 AAATACAAGAACAGAAACAAAGG + Intergenic
1048120936 8:131581139-131581161 AAAGACAAGAAGTTAAACAAGGG - Intergenic
1048275792 8:133064919-133064941 AAATTGAGGAAGTCCAACCAAGG + Intronic
1048790401 8:138098415-138098437 AAACTCTTGTAGTGAAACCAGGG - Intergenic
1049126502 8:140794075-140794097 AGATTAAAGAGGTTAAACCAGGG - Intronic
1050121137 9:2308392-2308414 AAATTAAACAATTGAACCCATGG - Intergenic
1051846938 9:21462794-21462816 AAAATAAAAAAGTAAAACCAAGG + Intergenic
1051963605 9:22799091-22799113 AAATTCAGGACGTGAAAGCACGG - Intergenic
1052111582 9:24591491-24591513 GAATTTAAGAAGTGAAATAAAGG - Intergenic
1052648252 9:31267152-31267174 ACATTAAAGAAGTGAACCCTGGG - Intergenic
1056270127 9:84939419-84939441 AAATTCAATAAATGAAAATATGG - Intronic
1056455956 9:86760402-86760424 AACCTCAGAAAGTGAAACCAAGG + Intergenic
1056888843 9:90470471-90470493 AAAGAAAATAAGTGAAACCAAGG - Intergenic
1056911238 9:90702746-90702768 ATATTCATGAAGGGGAACCATGG + Intergenic
1057953011 9:99385068-99385090 AGATTCAAGAAATGCAATCAAGG + Intergenic
1058170154 9:101670679-101670701 AAATTCAAGAAGTGCTGCTATGG - Exonic
1058177709 9:101756621-101756643 AAAATCATGAAGTTGAACCATGG + Intergenic
1058317050 9:103581284-103581306 AAATTCAAGAATTGAAATTTGGG - Intergenic
1060450443 9:123733585-123733607 AAATTAAGAAAGTGAAAGCAAGG - Intronic
1061770266 9:132914242-132914264 AATTCTTAGAAGTGAAACCATGG - Intronic
1185931188 X:4205266-4205288 AAATTTAAAAGGTGAATCCAGGG - Intergenic
1187631815 X:21181516-21181538 AATTTCCAGAAGTGAACCTAGGG + Intergenic
1187726308 X:22206217-22206239 AAATTCAAGAAGTAATACATTGG + Intronic
1187957778 X:24536813-24536835 AAATTCAAGAAGAGAACCTATGG - Intronic
1188561629 X:31474749-31474771 AAATAAAAAAAGAGAAACCATGG + Intronic
1188777338 X:34236417-34236439 AAATACAGCAAGTGAAACTAGGG + Intergenic
1189092171 X:38095548-38095570 ATTTTCAAAAAGTGAAAACAAGG + Intronic
1189205343 X:39233517-39233539 AGAGTCAAGAAGTAAAACCATGG - Intergenic
1189651438 X:43194021-43194043 AAATACAAAAAGGAAAACCAGGG - Intergenic
1190088436 X:47416678-47416700 AAAGTAATGAAGTGCAACCAAGG - Intergenic
1194224097 X:91233577-91233599 AAAATCAAGAAGATAAAACATGG + Intergenic
1194889585 X:99362106-99362128 ATGTTCAAGGAGTGATACCAGGG + Intergenic
1194933632 X:99919460-99919482 TAATTAAAAAAGTAAAACCAAGG - Intergenic
1195752247 X:108170712-108170734 AAATCCTAAATGTGAAACCAAGG + Exonic
1196861864 X:120036207-120036229 AAAACAAGGAAGTGAAACCAAGG - Intergenic
1197157820 X:123289507-123289529 AATTTCTAGAAGTGAGACCTGGG + Intronic
1197165833 X:123376767-123376789 CAGCTCAAGAAGTGAAACCTGGG + Intronic
1197367912 X:125588903-125588925 AAATTTAAGAAGTGAAAAACTGG + Intergenic
1197662721 X:129191379-129191401 GAATTCAATGAGTGACACCAAGG - Intergenic
1197786763 X:130206342-130206364 AAACTAAAGAAGTCAATCCAAGG - Intronic
1197882290 X:131179590-131179612 AGATATAAGAAGTTAAACCACGG - Intergenic
1198314951 X:135455841-135455863 AAATCCATGAAGTGAAAGCCAGG - Intergenic
1198472436 X:136960067-136960089 AAATTAAAAAAGTGAAAGTAAGG + Intergenic
1198685091 X:139220479-139220501 AAACCCCAGAAGTGAAACCCAGG + Intronic
1198860483 X:141063952-141063974 AAATAAAAGAAGTAAAATCAGGG - Intergenic
1198902207 X:141523438-141523460 AAATAAAAGAAGTAAAATCAGGG + Intergenic
1198940186 X:141945796-141945818 AACTGCACAAAGTGAAACCATGG + Intergenic
1199110898 X:143932805-143932827 AAATCTAAGACCTGAAACCATGG - Intergenic
1199662276 X:150063837-150063859 ACAATCAGGAAGTGAAACCTAGG - Intergenic
1199925298 X:152456616-152456638 AAATCAAAGAATTGAACCCATGG + Intergenic
1200560561 Y:4696944-4696966 AAAATCAAGAAGATAAAACATGG + Intergenic
1201326282 Y:12763250-12763272 AAATTCAAGTAGTGAGACAAGGG - Intronic
1201918022 Y:19203623-19203645 AAATTAGAGAAATTAAACCAAGG - Intergenic