ID: 1001748927

View in Genome Browser
Species Human (GRCh38)
Location 5:174112959-174112981
Sequence GAGCTGGAGGCCATCATTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 24, 2: 126, 3: 372, 4: 476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001748927_1001748934 21 Left 1001748927 5:174112959-174112981 CCGAGAATGATGGCCTCCAGCTC 0: 1
1: 24
2: 126
3: 372
4: 476
Right 1001748934 5:174113003-174113025 CATGATCTCATTCCTTTTTATGG 0: 1073
1: 2502
2: 5786
3: 14197
4: 23872
1001748927_1001748930 -3 Left 1001748927 5:174112959-174112981 CCGAGAATGATGGCCTCCAGCTC 0: 1
1: 24
2: 126
3: 372
4: 476
Right 1001748930 5:174112979-174113001 CTCCATTCATGTCCCTGCAAAGG 0: 104
1: 1629
2: 8347
3: 15382
4: 18432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001748927 Original CRISPR GAGCTGGAGGCCATCATTCT CGG (reversed) Intronic
900353621 1:2249143-2249165 GAGTTGGAGGCCAGCTTTCATGG + Intronic
900723709 1:4200053-4200075 GAGTTGGAGACCATTATTCGGGG + Intergenic
901989636 1:13102400-13102422 GAGTGGGAGGCCTTCCTTCTTGG - Intergenic
901992176 1:13124352-13124374 GAGTGGGAGGCCTTCCTTCTTGG + Intergenic
902395507 1:16130387-16130409 GAGCCGGAAGCCATCATTGATGG + Exonic
902884129 1:19392915-19392937 GACCTGGAGGCCATCTCCCTAGG - Intronic
903913694 1:26747635-26747657 GAGCTGGAGACCACCACCCTGGG + Intronic
904009640 1:27382459-27382481 GAGCTGGGGGCACTCAATCTGGG + Intronic
906069166 1:43005221-43005243 GAGATGGAGGCCATCGCCCTTGG + Intergenic
906840462 1:49133100-49133122 AAGCTAGAAACCATCATTCTCGG + Intronic
907598182 1:55739599-55739621 GAGCTGGAAGCCATTATCCTCGG - Intergenic
908600837 1:65738146-65738168 AAGCTGGAAACCATCATTCTTGG - Intergenic
908668082 1:66514653-66514675 GAACTGGAGACTATTATTCTAGG + Intergenic
908868840 1:68584352-68584374 AAGCTAGAAACCATCATTCTCGG + Intergenic
908887300 1:68804322-68804344 GAGCTGGAGGTCATTATCCTTGG + Intergenic
909168550 1:72261724-72261746 AAACTGGAGGCCATTATCCTAGG + Intronic
909230248 1:73079937-73079959 GAGCTGGAGGTGATCATCCTTGG - Intergenic
909880960 1:80877600-80877622 GAACTGGAAGCCATTTTTCTAGG - Intergenic
910452894 1:87364871-87364893 AAGCTGGAAACCATCATTCTCGG - Intergenic
910592260 1:88938665-88938687 GAGCTGGAGCCTATTATCCTTGG - Intronic
910686663 1:89924776-89924798 CAGCTGCAGGCCATTATCCTAGG + Intronic
911165846 1:94723750-94723772 GAGATGGAGGTCAGCATTCTGGG - Intergenic
911429196 1:97761867-97761889 GAGCTGAAGGCCATTATCCTAGG + Intronic
911613632 1:99984372-99984394 GAATTGGAGACCATTATTCTAGG - Intronic
912464468 1:109861843-109861865 AAGCTGGAAACCATCATTCTGGG + Intergenic
912574860 1:110659797-110659819 AAGCTGGAAACCATCATTCTCGG + Intergenic
912822147 1:112876565-112876587 GAGCTGGAGGCTATCATTCTTGG + Intergenic
913318964 1:117575638-117575660 GAGCTGGAAGCTGGCATTCTGGG + Intergenic
913341643 1:117763766-117763788 GAGCTGGATGCTATTATCCTAGG - Intergenic
913433567 1:118823028-118823050 AAGCTGGAAACCATCATTCTCGG - Intergenic
913647346 1:120871139-120871161 AAGCTGGAAACCATCATTCTCGG - Intergenic
914174196 1:145260268-145260290 AAGCTGGAAACCATCATTCTCGG + Intergenic
914195338 1:145445542-145445564 GAGCTGGAGGCCGTGAGGCTGGG - Intergenic
914949382 1:152099014-152099036 GAACTGGAGGACATTATTCTGGG + Intergenic
915682274 1:157592948-157592970 AAGCTGGAAACCATCATTCTCGG + Intronic
915689364 1:157673131-157673153 GAGCTGGAGGTCATTATCCTGGG - Intergenic
916413453 1:164570487-164570509 AAGCTGGAAACCATCACTCTCGG - Intronic
916444586 1:164860564-164860586 GTGTTAGGGGCCATCATTCTAGG - Intronic
916865900 1:168858394-168858416 AAGCTGGAAGCCATCATCCTAGG + Intergenic
918584397 1:186169046-186169068 AAGCTGGAAACCATAATTCTTGG - Intronic
918655789 1:187024558-187024580 AAGCTGGAAACCATCATTCTCGG + Intergenic
918731427 1:188001957-188001979 GAGCTGGAGGCCATTATTTTAGG - Intergenic
918901615 1:190428023-190428045 GATCTGGAGGCCATTATCCTTGG - Intronic
919023391 1:192137029-192137051 CAGGTGGGAGCCATCATTCTGGG - Intergenic
919084888 1:192910139-192910161 AAGCTGGAAACCATCATTCTCGG + Intergenic
919304661 1:195816568-195816590 AAGCTGGAGGCCATAATCTTAGG - Intergenic
919305003 1:195821156-195821178 GAGCTGGAGGCAACTATCCTAGG + Intergenic
919453008 1:197792820-197792842 GAGCTGGAGGCCATTATCCTGGG - Intergenic
919618619 1:199839054-199839076 TAGCTGGAGACCATTATCCTCGG + Intergenic
920500116 1:206480355-206480377 GAGGTGGAGGCCAGTATCCTGGG + Intronic
920542440 1:206789465-206789487 GAACTGGAGGCCATTATTCTAGG - Intergenic
921489184 1:215753523-215753545 AAGGTGGAAACCATCATTCTCGG + Intronic
921493246 1:215804996-215805018 AAGCTGGAAACCGTCATTCTCGG + Intronic
921509955 1:216016055-216016077 AAGCTGGAAACCATCATTCTGGG + Intronic
923321487 1:232838271-232838293 CAGCTGGAGGCCATAATCCTAGG + Intergenic
923741024 1:236655103-236655125 CAGCTGCATGCCATCATGCTCGG + Intergenic
924021096 1:239783989-239784011 TAGCTGGAGGCCATTATCCTCGG - Intronic
924124831 1:240839653-240839675 GAGGTGAAGGGCAGCATTCTTGG + Intronic
924267253 1:242295421-242295443 CAGCTGGAGGCCATTATCCTAGG - Intronic
924275394 1:242381260-242381282 GAGCTGGAGGCCATTATCCTTGG + Intronic
924895627 1:248335651-248335673 GAGCTGGAGATCATTATTCTAGG - Intergenic
1062968423 10:1627889-1627911 GAGCTGGAGGGCATCAGCCATGG + Intronic
1063241365 10:4173307-4173329 GAACTGGAGGCCATTGTCCTAGG + Intergenic
1063483970 10:6402060-6402082 AAGCTGGAAACCATCATTCTCGG + Intergenic
1064248421 10:13688256-13688278 AAACTGGAAACCATCATTCTCGG + Intronic
1064366558 10:14713890-14713912 GAGTTGGAGGTCATTATTCCAGG + Intronic
1064522901 10:16222429-16222451 GAGCTGGAAGCTATTATCCTCGG - Intergenic
1064711661 10:18133282-18133304 AAGCTGGAAACCATCATCCTTGG + Intergenic
1064752298 10:18543221-18543243 CAGCTGCAGGGCATCTTTCTTGG + Intergenic
1065384531 10:25121373-25121395 GAGCTGGAGGCCATTATCTTAGG + Intergenic
1065410650 10:25423663-25423685 AAGCTGGAAACCATCATTCTTGG - Intronic
1065426470 10:25609596-25609618 GAGCTGGAGGTCATTATGTTAGG - Intergenic
1065428341 10:25628786-25628808 GAGGTGGAGGCCATCATCCTCGG - Intergenic
1065634873 10:27721487-27721509 GAGCTGGAAGCCATTAGCCTTGG + Intronic
1066492320 10:35905752-35905774 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1066717570 10:38303085-38303107 CAGCTGGAGGCCATTATCCTAGG + Intergenic
1066780868 10:38943235-38943257 GACCTGGAGGCCCACAATCTTGG + Intergenic
1068100936 10:52551988-52552010 GAGCTTGAGGCCATTATCGTAGG - Intergenic
1068411141 10:56656833-56656855 AAGCTGGAAACCATCATCCTCGG - Intergenic
1068474640 10:57508808-57508830 CAGCTGAAGGCCATTATCCTAGG - Intergenic
1068725322 10:60294419-60294441 CAGCTGGTGGCCAACATTTTAGG - Intronic
1068948929 10:62758045-62758067 GAGCTGGAAGCCATTATCCTTGG - Intergenic
1069039522 10:63680659-63680681 AAGCTGGAAACCATCATTCTTGG - Intergenic
1069101813 10:64331619-64331641 GAGCTAGAGGCCATTATCCTTGG - Intergenic
1069122062 10:64578987-64579009 AAACTGGAAACCATCATTCTCGG + Intergenic
1069493230 10:68879535-68879557 GAGATGGTGGACATGATTCTGGG - Intronic
1069573868 10:69511802-69511824 AAGCTGGAAGCCATCATTCTCGG + Intergenic
1069650584 10:70044249-70044271 AAGCTGGAAGCCATCATTCTCGG - Intergenic
1070798929 10:79233686-79233708 GAGCTGTGGGCCAGCAGTCTGGG - Intronic
1071005125 10:80875299-80875321 AACCTGGAGACCATCATTCTTGG - Intergenic
1071010497 10:80934820-80934842 GAACTGGAGGCCATTATCCTTGG + Intergenic
1071063248 10:81599395-81599417 AAGCTGGAGGCCATTATCCTTGG + Intergenic
1071247210 10:83778093-83778115 GAACTGGAGGCCATTACCCTAGG + Intergenic
1071687286 10:87772991-87773013 AAGCTGGAGGCCATGATTCTTGG - Intronic
1072714528 10:97741476-97741498 AAGCTGGAAACCATCATTCTCGG + Intronic
1073690237 10:105800018-105800040 AAGCTGGAAACCATCATTCTCGG + Intergenic
1073928041 10:108539911-108539933 GACCTGGAGACCTTCATACTGGG + Intergenic
1073989905 10:109250957-109250979 GAGCTGGAGGCCATTATGCTTGG - Intergenic
1074026462 10:109640902-109640924 GAGATGGAGGCCATTATCCTTGG - Intergenic
1074270383 10:111947777-111947799 GAGCTGGAGGTCATTATCCTTGG + Intergenic
1075385928 10:122055421-122055443 GAGCTGGAGGTCATTATCCTTGG + Intronic
1075542032 10:123322173-123322195 GAACTGGAGGCCATCATCCTAGG - Intergenic
1075628480 10:123983837-123983859 GAGCTGGAGGCAATTATCCTAGG + Intergenic
1075666759 10:124236478-124236500 GAGCTGGAGGCCATATGCCTGGG + Intergenic
1075943962 10:126416486-126416508 GAGCTGGAAGCGATTATCCTCGG + Intergenic
1076504894 10:130965098-130965120 GACCTGGAGGCCAGCCTGCTGGG - Intergenic
1076592980 10:131601882-131601904 AAGCTGGAGGCTATTATCCTTGG + Intergenic
1077497433 11:2892912-2892934 GAGCTGGGGGCCAGCAATCAGGG + Intronic
1077697633 11:4409020-4409042 AAGCTGGAAACCATCATTCTCGG + Intergenic
1077864604 11:6211841-6211863 GAGCCGGAGGCCATCCTTGGGGG - Exonic
1078039129 11:7841547-7841569 GAGATGGAGGCCATTATCCTAGG - Intergenic
1078109330 11:8379908-8379930 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1078293165 11:10036123-10036145 AAGCTGGAAACCATAATTCTCGG + Intronic
1078975291 11:16467497-16467519 GAGCTGGAGGCCATTATCGTTGG + Intronic
1079317079 11:19417832-19417854 AAGCTGGAAACCATCATTCTTGG + Intronic
1079548233 11:21661749-21661771 GAGCTGGAGGCCATTAATCTAGG + Intergenic
1079579192 11:22041191-22041213 GGGCTGGATGTCTTCATTCTGGG + Intergenic
1079674842 11:23213628-23213650 CAGGTGGAAGCCATCATTCCAGG + Intergenic
1079945591 11:26736876-26736898 GAGCTGGAGGCCATTATCCTAGG + Intergenic
1080033070 11:27682687-27682709 AAGCTGGAAACCATCATTCTTGG - Intronic
1080249242 11:30214320-30214342 CAGCTGGAGGCCATTATCCTAGG - Intergenic
1080378892 11:31746600-31746622 AAACTGGATACCATCATTCTTGG + Intronic
1080733128 11:34981279-34981301 AAGCTGGAAACCATCATTCTCGG - Intronic
1080844308 11:36013586-36013608 AAGCTGGAAGCCATCACTCTCGG - Intronic
1080908820 11:36574661-36574683 GAGCTGGAGGCCATCATGCAGGG + Exonic
1081051024 11:38341732-38341754 AAGCTGGAAACCATCATTCTCGG - Intergenic
1081096737 11:38945570-38945592 AAGTTGGAAACCATCATTCTTGG + Intergenic
1081334180 11:41843409-41843431 CAACTGGAGGCCATTATCCTAGG + Intergenic
1081610444 11:44559647-44559669 GTGCTGGAGCCCAGCTTTCTGGG + Intergenic
1081624881 11:44647389-44647411 GAGTTGGAAGCCATTATCCTTGG - Intergenic
1081696413 11:45112225-45112247 GAGCTGGAGGCCATTATTCTAGG - Intronic
1081855627 11:46301492-46301514 GTGATGGAGGGCATCATGCTGGG - Intronic
1082143934 11:48644491-48644513 AAGCTGGAAACCATCATTCTCGG - Intergenic
1082274774 11:50209472-50209494 GAACTGGAGGCCATAATCCTAGG + Intergenic
1082560731 11:54617895-54617917 AAGCTGGAAACCATCATTCTCGG + Intergenic
1082637931 11:55619412-55619434 AAGCTGGAAACCATCATTCTCGG - Intergenic
1082700526 11:56424281-56424303 AAGCTGGAGGCCATTATCCTTGG + Intergenic
1082726105 11:56738504-56738526 AAGCTGGAAGCCATCATTGTTGG - Intergenic
1082742082 11:56922159-56922181 GAGATGGAGGCCATTATCCTAGG + Intergenic
1082810800 11:57477694-57477716 GAGCTGAAGCCCTGCATTCTAGG + Intergenic
1082900811 11:58249323-58249345 GAGCTGGAGGCCATTATTCTTGG - Intergenic
1082982983 11:59141245-59141267 GAGCTAGAGGCCATTATTCTTGG - Intergenic
1083132938 11:60643464-60643486 CAGCTGGAGACCATTATCCTAGG + Intergenic
1083135089 11:60665735-60665757 CAGCTGGAGGCCATTGTCCTAGG + Intergenic
1083520777 11:63310568-63310590 GAGCTGGAAAACATTATTCTAGG + Intronic
1085379456 11:76100888-76100910 GAGCTGGAGATCATTATCCTTGG - Intronic
1085434362 11:76486113-76486135 AAGCTGGAAACCATCATTCTTGG + Intronic
1085672824 11:78485097-78485119 AAGCTGGAAGCCATCATTCTAGG + Intronic
1085814789 11:79726401-79726423 CAGCTGGAGGCTATTATCCTAGG - Intergenic
1085888580 11:80550446-80550468 CAGCTGGAGGCCATTATCCTAGG + Intergenic
1085966501 11:81534571-81534593 AAGCTGGAAACCATCATTCTTGG - Intergenic
1085998360 11:81949886-81949908 GAGTTGGAGGCCATTATTCTAGG - Intergenic
1086303396 11:85454043-85454065 GAGCTAGAGACCATTATCCTGGG - Intronic
1086512055 11:87569657-87569679 GAGTTGGAGACCATTATTCTAGG + Intergenic
1086724403 11:90165099-90165121 GAGATGAAGACCATTATTCTTGG - Intronic
1087311647 11:96550875-96550897 AAGCTGGAAACCATCATTCTCGG + Intergenic
1087360404 11:97151406-97151428 GAGCTGGAGGCCATTATCCTAGG - Intergenic
1087398441 11:97633247-97633269 AAGCTGGAAACCATCATTCTGGG - Intergenic
1087512791 11:99119419-99119441 GAGCTGGAGGCCATTATCCTTGG - Intronic
1087521461 11:99242764-99242786 GAGCTGGAGGCCATTATCCTAGG - Intronic
1087531989 11:99394823-99394845 GAGCTGGAGGCCATTATTCTTGG - Intronic
1087552340 11:99667657-99667679 AAGCTGGAAGCCATCATCCTCGG + Intronic
1087686274 11:101269102-101269124 AAGCTGGAAACCCTCATTCTTGG - Intergenic
1087975779 11:104544760-104544782 AAGCTGGAAACCATCATTCTCGG + Intergenic
1088084012 11:105956387-105956409 AAGCTGGAATCCATCATTCTGGG - Intronic
1089005406 11:115086651-115086673 AAGCTGGAAACCATCATTCTCGG - Intergenic
1089352995 11:117831950-117831972 GAGCTGGAGAACCCCATTCTGGG - Intronic
1089529653 11:119118374-119118396 GAACTGGAGGCCATTATCCTCGG - Exonic
1091693266 12:2611263-2611285 GAGCTGGATGCGTTCATTTTTGG + Intronic
1091693312 12:2611477-2611499 GAGCTGGATGCATTCATTGTTGG + Intronic
1091954734 12:4629229-4629251 GAGCTGGAAGTCATTATCCTTGG - Intronic
1092076709 12:5679999-5680021 GAGTTGGAAGCCATTATTCTCGG + Intronic
1092503552 12:9071722-9071744 GAGATGGAGGTCATTATCCTTGG - Intronic
1092627331 12:10340737-10340759 GAGCTGGAGGCCATTATCCTCGG - Intergenic
1093327718 12:17799971-17799993 GAACTGGAGGCCATTATCCTAGG + Intergenic
1093523029 12:20072617-20072639 AGGCTGGAAGCCATCATCCTCGG + Intergenic
1093685236 12:22046726-22046748 GAGCTGGAGCCCTTCCTCCTGGG - Intronic
1093707658 12:22292608-22292630 CAGCTGGAGGCCATTATCCCAGG + Intronic
1093716712 12:22391089-22391111 GAACTGGGGACCATTATTCTAGG + Intronic
1093770512 12:23012164-23012186 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1093993321 12:25614402-25614424 GAGCTGGAGGTCAGCATTTAAGG - Intronic
1094070580 12:26408542-26408564 GACCTGGAAGACCTCATTCTAGG + Intronic
1094157650 12:27354279-27354301 GAGCTGGAGGTTATTATCCTAGG + Intronic
1094694529 12:32804580-32804602 GAGCTGGAGGCTGTTATCCTTGG - Intronic
1094770190 12:33648783-33648805 GAGCTGGAGGACATTATCCTAGG - Intergenic
1095202968 12:39407099-39407121 GAGCTGGAAGGAATAATTCTAGG - Intronic
1095843417 12:46719679-46719701 GCACTGGAGGCCATTATGCTAGG - Intergenic
1096766859 12:53898185-53898207 AAGCTGGAAACCATCATTCTTGG - Intergenic
1096995997 12:55838605-55838627 GAACTGGATGCCATGATGCTGGG - Exonic
1097305450 12:58063723-58063745 AAGCTGGAAACCTTCATTCTTGG + Intergenic
1097400058 12:59117634-59117656 GAGGTGGAATGCATCATTCTGGG + Intergenic
1097620937 12:61938768-61938790 GAGCTAGAGGCCATTATTCTAGG + Intronic
1097649959 12:62285372-62285394 GAACTGGAGGCCATTATCTTAGG - Intronic
1097776041 12:63647503-63647525 AAGCTGGAAACCATCATTCTTGG + Intronic
1098325131 12:69294087-69294109 AAGCTGGAAATCATCATTCTCGG + Intergenic
1098550306 12:71754939-71754961 GGGCTGGGGCCCTTCATTCTCGG + Exonic
1098798813 12:74926891-74926913 AAGCTGGAAACCATCATTCTTGG + Intergenic
1098799493 12:74936042-74936064 AAGCTGGAAACCATCATTCTTGG - Intergenic
1099415483 12:82380250-82380272 GAGCTGGAGGTCATTATCCTTGG - Intronic
1099562713 12:84198062-84198084 AAGCTGAAAACCATCATTCTCGG + Intergenic
1099825590 12:87773310-87773332 GAGCTGGAGGCAATTATCCTAGG - Intergenic
1101057451 12:100933398-100933420 AAGCTGGAAACCATCATTCTTGG - Intronic
1101067302 12:101035714-101035736 GAGCTGAAGGCCATTATCCTAGG + Intronic
1101067804 12:101040882-101040904 AAGCTGGAAACCATCATTCTCGG - Intronic
1101184177 12:102255916-102255938 AAGGTGGAAACCATCATTCTTGG + Intergenic
1101563025 12:105877766-105877788 AAGGTGGAAACCATCATTCTCGG - Intergenic
1102350877 12:112191146-112191168 GAGATGGAGGCCATCCCTCCAGG + Intronic
1103047901 12:117753524-117753546 GAGCTGGAAGCCATTATCCTTGG + Intronic
1103311017 12:120008299-120008321 CAGCTGTAAGCCACCATTCTTGG + Intronic
1104241259 12:126991980-126992002 GAGCTGGAGGCCATTATCCACGG - Intergenic
1104292362 12:127482216-127482238 GAGTGGGAGGCCTTCCTTCTTGG - Intergenic
1104493485 12:129215171-129215193 GAGCTGGAGGCCATTATCCTTGG + Intronic
1105379708 13:19875687-19875709 CAGCTGGAGGCCATTATCCTAGG + Intergenic
1106008186 13:25791246-25791268 GAGCTGGAGGCCATTATCGTTGG + Intronic
1106267758 13:28125268-28125290 TAGCTGGAGGCCACTACTCTAGG + Intergenic
1107169308 13:37321101-37321123 GAGCTGGAGGCCATTATCCTAGG + Intergenic
1107783798 13:43934007-43934029 AAACTGGAGGACCTCATTCTGGG - Intergenic
1107919485 13:45189181-45189203 AAGCTGGAAACCATCATTCTCGG - Intronic
1108084411 13:46770071-46770093 AAGCTGGAAACCGTCATTCTCGG - Intergenic
1108162845 13:47660552-47660574 AAGCTGGAGGCCATTATCCTTGG - Intergenic
1108181856 13:47848112-47848134 GAGTTGGAGACCATGATTATAGG - Intergenic
1108759088 13:53541136-53541158 GAACTGGAGGCCATCACCCTCGG + Intergenic
1109002667 13:56826039-56826061 AAGCTGGAAACCATCATTCTTGG + Intergenic
1109022267 13:57113065-57113087 GAGCTGGAAGCCATTATCCTCGG + Intergenic
1109113725 13:58354695-58354717 AAGCTGGAAGCCATCATCCTCGG - Intergenic
1109347952 13:61139747-61139769 GAGCTGGAGGCCATTATCCTTGG + Intergenic
1109407680 13:61922393-61922415 GAGCTGGAAGACATTATCCTCGG - Intergenic
1109610293 13:64756411-64756433 GAGCTGGAGGCTATTATCCTTGG - Intergenic
1109775903 13:67040576-67040598 GTGCTGGAGGCCACAAGTCTGGG - Intronic
1109873014 13:68361958-68361980 GAGCTGGAGGCCATTATTGTAGG + Intergenic
1110064509 13:71087106-71087128 GAGCTGGAGGCCATTATCCTTGG + Intergenic
1110143873 13:72165886-72165908 GAGCTGGAGGCCATGAGACTTGG - Intergenic
1110159566 13:72359439-72359461 AAGCTGGAAACCATCATTCTCGG + Intergenic
1110562770 13:76927134-76927156 AAGCTGGAAGCCATCATCCTTGG + Intergenic
1110610547 13:77482489-77482511 GAGCTAGAGGCCATTATCCATGG - Intergenic
1110638768 13:77797277-77797299 CAGATGAAGGCCATCATACTAGG + Intergenic
1111049654 13:82864169-82864191 GAGATGACGGCAATCATTCTTGG + Intergenic
1111286624 13:86102285-86102307 AAGCTGGAAGCCATCATCCTCGG - Intergenic
1111334060 13:86798603-86798625 GACCTGGAGGACATTATGCTAGG - Intergenic
1111771833 13:92606366-92606388 AAGCTGGGAACCATCATTCTGGG - Intronic
1112137384 13:96596226-96596248 GAGCTGGAGGCCATTATCCTAGG - Intronic
1112667531 13:101593626-101593648 GAACTGGAGGTCATCATGTTAGG + Intronic
1113122255 13:106936087-106936109 GAACTGGAGGCCATTTTCCTTGG + Intergenic
1113314074 13:109160031-109160053 GAGCTGGATACTATAATTCTAGG + Intronic
1113314969 13:109169152-109169174 GAACTGGAGGCCATTATCTTAGG - Intronic
1113511873 13:110862943-110862965 GAGCTGCAGGCCATTATCCTTGG + Intergenic
1114035336 14:18620822-18620844 AAACTGGAAGCCATCATCCTCGG - Intergenic
1114123307 14:19694201-19694223 AAACTGGAAGCCATCATCCTCGG + Intergenic
1114148726 14:20009588-20009610 GAGCTGGAGGCCATTATCCTTGG + Intergenic
1114759141 14:25292330-25292352 GAGCTGGAGGCCATTACTTTTGG + Intergenic
1114760253 14:25306418-25306440 GAGCTGGAGGTCATTACTTTTGG + Intergenic
1114867691 14:26617628-26617650 GAGCTGAAGGCCATTATCCTAGG + Intergenic
1114972310 14:28048141-28048163 GAGCTGAAGGCCATGATTCTAGG - Intergenic
1115027298 14:28760045-28760067 GAGCCAGAGGCCTTGATTCTAGG - Intergenic
1115094362 14:29617082-29617104 GAGCTGGAGGCCATTTTCCTAGG - Intronic
1115115614 14:29878011-29878033 TAGCTGGAGGCCATTATCCTTGG + Intronic
1115536854 14:34381448-34381470 GAGCTGGAGGCCATTATCCTAGG - Intronic
1115781181 14:36770230-36770252 CAGCTGGAGGTCATCATCCTAGG + Intronic
1116182556 14:41553742-41553764 GAGCTGGAGACCATTATCCTAGG + Intergenic
1116471987 14:45296124-45296146 GAGCTGGAGGCCATTATCCTTGG + Intergenic
1116536363 14:46036068-46036090 GAACTGGAGGCCATTATCCTAGG + Intergenic
1116680880 14:47968435-47968457 AAGCTGGAAGCCATCATTCTCGG - Intergenic
1116753723 14:48919563-48919585 TAGCTGGAGGCCATTATTCTAGG + Intergenic
1117080244 14:52144220-52144242 GAGCTGGAGGCTGTAATTCAAGG - Intergenic
1117272061 14:54154764-54154786 GAGCTGGAAGCCATTATCCTTGG - Intergenic
1117496577 14:56311553-56311575 CAGCTAGAGGCCAGCATTCAAGG + Intergenic
1117503953 14:56382128-56382150 GAACTGGAGGCCATTATGCTAGG - Intergenic
1117822437 14:59664179-59664201 AAGCTGGAAACCATCATTCTCGG + Intronic
1118119638 14:62824888-62824910 CAGCTGGAGGCCATTATCCTAGG - Intronic
1118651800 14:67904034-67904056 GAGCTGGAGGCCATTATCCTAGG - Intronic
1118660282 14:68001826-68001848 GAACTGGAGGCCATTATCCTCGG - Intronic
1118856932 14:69630451-69630473 GAGCTTGGAGCCATCTTTCTTGG + Intronic
1119497230 14:75090253-75090275 CAGCTGGGAGCCATCATGCTCGG + Intronic
1120664246 14:87287109-87287131 GAGCTGGAGACAATCATGGTGGG + Intergenic
1120830841 14:88996158-88996180 CACCTGGAGGCCAGAATTCTTGG - Intergenic
1121163777 14:91771795-91771817 GAGCTGGAGACCATTATCCTAGG + Intronic
1121750830 14:96354404-96354426 GAGCTGGAAGCCGTTATCCTTGG - Intronic
1122888461 14:104722058-104722080 GAGCTTGGGGCCATCCATCTGGG - Intronic
1123039816 14:105485931-105485953 GCGCTGGAGACCATCCTCCTGGG - Intergenic
1202939712 14_KI270725v1_random:135919-135941 GACCTGGAGGCCCACACTCTTGG - Intergenic
1123603172 15:21995684-21995706 AGGCTGGAAACCATCATTCTCGG + Intergenic
1125252235 15:37718088-37718110 AAGCTGAAAGCCATCATTCTCGG - Intergenic
1125331447 15:38586574-38586596 AAGCTGGAAACCATCATTCTGGG + Intergenic
1125397342 15:39263620-39263642 AAGCTGGAAACCATCATTCTTGG + Intergenic
1126220879 15:46211341-46211363 CATCTGGAGACCATCATTCTGGG + Intergenic
1127040438 15:54969573-54969595 AAGCTGGAAACCACCATTCTCGG + Intergenic
1129010988 15:72417024-72417046 AAGCTGGAAACCATCATTCTCGG + Intergenic
1129623464 15:77171384-77171406 GAACTGGAGGACATTATGCTAGG + Intronic
1130754730 15:86750919-86750941 GAACTGGAAGCCATTATCCTCGG - Intronic
1133026312 16:2990375-2990397 GAGCTGGAAGCCAGGATTCTAGG + Intergenic
1133443881 16:5843415-5843437 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1133582962 16:7164244-7164266 GAGCTGAAAACCATTATTCTAGG - Intronic
1133786326 16:8976186-8976208 AAGCTGGAAACCATCATTCTGGG - Intergenic
1134391916 16:13827863-13827885 GAGCTGGAGGCCATTATCCTAGG - Intergenic
1134559239 16:15193699-15193721 GTGCTGGTGGCCATTTTTCTGGG + Intergenic
1134919776 16:18105312-18105334 GTGCTGGTGGCCATTTTTCTGGG + Intergenic
1135777244 16:25267524-25267546 GAGCTGGAGGCAATTATCCTAGG + Intergenic
1135856364 16:26014623-26014645 GAGCTGAAGGCCATTATCCTAGG - Intronic
1137032920 16:35541866-35541888 GAACTGGAGGCCATTATTGTAGG + Intergenic
1137415918 16:48279449-48279471 GGCCTGGCTGCCATCATTCTGGG + Intronic
1138948555 16:61882583-61882605 GAACTGGAGGCCATTATCCTTGG + Intronic
1139009894 16:62619002-62619024 GACCTGGAGGCCATTATCCTAGG + Intergenic
1139147302 16:64340308-64340330 CAGCTGGAGGCAATTATGCTAGG - Intergenic
1140330294 16:74049805-74049827 GAGCTGGAGGCCATTATTCTAGG - Intergenic
1140545365 16:75802791-75802813 GAGCTGAAGGCCATTATCCTTGG - Intergenic
1140585278 16:76283520-76283542 GTGCTGGAGACCACTATTCTTGG + Intronic
1140785269 16:78335406-78335428 GAGCTGGAAGCCGTTATCCTAGG - Intronic
1140901983 16:79376802-79376824 AAGCTGGAAACCATCATTCTCGG - Intergenic
1142138004 16:88460372-88460394 GAGCTGCCTGCCATCTTTCTGGG + Intronic
1142639914 17:1279900-1279922 GACCTGGAGGCCCTCAGTCTGGG + Exonic
1142749477 17:1978519-1978541 GAGCTGTTGGCCACTATTCTTGG - Intronic
1144038784 17:11390114-11390136 GAGGCTGAGGCCATGATTCTAGG - Intronic
1144549973 17:16231826-16231848 GAGTTTGAGACCATTATTCTAGG - Intronic
1145727087 17:27139773-27139795 GAGCTGGAGGCAATTATCCTTGG + Intergenic
1146427250 17:32753135-32753157 GAGCTGGAGGCCATTATACTAGG + Intronic
1146622554 17:34410698-34410720 GAGCTGGAGGTCATTATCCTTGG + Intergenic
1148191925 17:45685199-45685221 AAGCTGGAAACCATCATTCTCGG - Intergenic
1148231436 17:45937686-45937708 GAGGAGGCGGCCGTCATTCTGGG + Intronic
1151092658 17:71460501-71460523 GTGCTGGAGGCCATTTTTCTTGG - Intergenic
1151143940 17:72021281-72021303 GAACTGGAGGCTATTATCCTTGG - Intergenic
1151552091 17:74828131-74828153 GAGGTGGAGGCCATCCGTCACGG - Intronic
1151565358 17:74894380-74894402 CATCCGGAGGTCATCATTCTGGG + Intergenic
1153368587 18:4287555-4287577 AAGCTGGAAACCATCATTCTCGG + Intronic
1153511952 18:5864520-5864542 AAGCTGGAAACCATCATTCTCGG + Intergenic
1153840999 18:9007870-9007892 AAGCTGGAAACCATCATTCTGGG + Intergenic
1153850907 18:9093341-9093363 AAGCTGGAAACCATCATTCTGGG + Intergenic
1153908934 18:9689389-9689411 AAGCTGGAAGCCATGATCCTTGG - Intergenic
1154006983 18:10539370-10539392 AAGCTGGAAGCCATCATTCTTGG + Intronic
1154010526 18:10570076-10570098 GAGTTGGAAGCCATTATCCTTGG - Intergenic
1155080632 18:22406734-22406756 AAGCTGGAAACCATCATTCTTGG + Intergenic
1155350290 18:24899634-24899656 AAGCTGGAAACCATCATTCTCGG + Intergenic
1156066744 18:33150959-33150981 GAGTTGGAGGCCATTATTCTAGG + Intronic
1156067562 18:33162712-33162734 GAGCTGGAGGCCATCATCCTTGG - Intronic
1156217639 18:35016078-35016100 CAGCTGGAGGCCATTATCCTGGG - Intronic
1156236604 18:35211509-35211531 AAACTGGAAACCATCATTCTCGG + Intergenic
1156441946 18:37199376-37199398 AAGCTGGAGGCCATTATCCTTGG - Intronic
1156743677 18:40363657-40363679 AAGCTGGAAACCATCATTCTTGG - Intergenic
1156928509 18:42612383-42612405 CAGCTGGAGGCCATTAACCTAGG - Intergenic
1157054696 18:44212802-44212824 CAGCTGGAGGCCATTGTCCTAGG + Intergenic
1158078412 18:53559923-53559945 AAGCTGAAGGCCATTATCCTAGG + Intergenic
1158751777 18:60270385-60270407 CAGCTAGAGGCCATTATCCTGGG - Intergenic
1159099902 18:63946479-63946501 AAGCTGGAAACCATCTTTCTCGG + Intergenic
1159518057 18:69483167-69483189 GATCTGGAGGCCATTACCCTTGG - Intronic
1159805095 18:72947000-72947022 AAGCTGGAAACCATCATTCTGGG + Intergenic
1159840859 18:73397014-73397036 AAGCTGGAAACCATCATTCTCGG - Intergenic
1159869989 18:73750428-73750450 CAGCTGGAGGCCATGATCCATGG + Intergenic
1160275324 18:77427652-77427674 GAGCTGGAGGCCATTATGTTAGG - Intergenic
1162123467 19:8486347-8486369 GAGCTGGAGGCCATGCTCCTGGG + Exonic
1162222265 19:9187813-9187835 GAACTGGAGGTCATTACTCTAGG - Exonic
1162493012 19:11005690-11005712 GAGCTGCAGGCCATGAGGCTTGG - Intronic
1164240927 19:23388553-23388575 AAGCTGGAGACCATTATTCTTGG + Intronic
1164422885 19:28112659-28112681 GAGCTGGAGGCCATTATTCTAGG + Intergenic
1164480518 19:28607955-28607977 GAGGGGGAGGCCTTCCTTCTTGG - Intergenic
1164553575 19:29232697-29232719 GTGCTGGAGGCCTGCCTTCTTGG - Intergenic
1164774126 19:30837806-30837828 GAGCTAGAGGCCATTATCCTTGG - Intergenic
1164849297 19:31468249-31468271 GAGCTGGAGGCAATGATTCTAGG + Intergenic
1164880600 19:31729536-31729558 GAGCTGGAGACTATTATCCTAGG + Intergenic
1164913888 19:32034369-32034391 TAGCTGCAGTGCATCATTCTGGG - Intergenic
1164922675 19:32101180-32101202 CAGGTGGAGGCCATTATTCTAGG - Intergenic
1164976378 19:32575722-32575744 CAGCTGGAGGCCTTTATCCTAGG - Intergenic
1165189522 19:34051000-34051022 GAACTGGAGGCCATTAGCCTTGG + Intergenic
1165289526 19:34872157-34872179 AAGCTGGAAGCCATTATTCTCGG + Intergenic
1165582585 19:36880647-36880669 TAGCTGGAGGCCACCATGCCTGG - Intronic
1166240032 19:41484695-41484717 GAACTGGAGGTCATTATTTTGGG + Intergenic
1166425965 19:42678077-42678099 AAGCTTGAAGCCATTATTCTTGG - Intronic
1166838539 19:45682237-45682259 GAGCTGGAGAACAGGATTCTAGG + Exonic
1166935340 19:46329250-46329272 GAGCTGGAAGTCATCATCCATGG - Exonic
1167842577 19:52134004-52134026 GAGCTGGAGGCGATTATCCTTGG - Intronic
1168327734 19:55546696-55546718 GAGCTGGAGGCCTGGACTCTTGG - Intergenic
1168412741 19:56149764-56149786 GAACTGGACGCCATCATCCTTGG - Intronic
1168479917 19:56711125-56711147 AAGCTGGAGGCCATTATCCTTGG - Intergenic
925000825 2:401514-401536 CAGCGGGAGCCCATCCTTCTTGG - Intergenic
925419377 2:3699283-3699305 CAGCTGGAGAGCATTATTCTTGG - Intronic
925485607 2:4326073-4326095 AAGCTGGAGGCCATCATACTCGG - Intergenic
925749562 2:7075331-7075353 CACCTGGAGCCCATCATGCTGGG - Intergenic
926930008 2:18027667-18027689 AAGCTGGAAGCCATCATTCTCGG - Intronic
927128078 2:20031749-20031771 GAGCTGGAGGCCATTATCCTAGG + Intergenic
927235053 2:20865607-20865629 GAGCTGGAGGCCATTATCCTAGG + Intergenic
927282730 2:21324648-21324670 AAGCTGGAAGCCATCATGCTCGG - Intergenic
927310549 2:21626040-21626062 AAGCTGGAAACCACCATTCTCGG - Intergenic
927469924 2:23366036-23366058 GGGCTGGAGGCTGTTATTCTAGG + Intergenic
928497025 2:31843450-31843472 AAGCTGGAAACCATTATTCTCGG + Intergenic
929548031 2:42868852-42868874 GTTCTGGTGGCCATCACTCTAGG + Intergenic
930282055 2:49381057-49381079 GAGGTGGAAACCATCATTCTCGG - Intergenic
930295317 2:49546809-49546831 AAGCTGGAAACCGTCATTCTGGG + Intergenic
930623290 2:53667379-53667401 AAGCTGGAAACTATCATTCTCGG + Intronic
931006716 2:57858091-57858113 TAGTTGGAGGCCATTATTCTAGG - Intergenic
932056615 2:68449463-68449485 GAGTTGGAGACCATTATTCTAGG - Intergenic
932853683 2:75213505-75213527 GAGCTGGAGTTCAGCAATCTGGG + Intergenic
932867346 2:75358010-75358032 GAGCTGGTGGCCATTATCCTTGG - Intergenic
932871164 2:75399804-75399826 AAGCTGGAGTCTATTATTCTAGG + Intergenic
933076475 2:77933889-77933911 ATGCTGGAAGCCATCATCCTCGG + Intergenic
933173188 2:79147045-79147067 GAACTGGAGGCTGTCACTCTAGG - Intergenic
933485883 2:82923054-82923076 AAGCTGGAAACCATCATTCTCGG - Intergenic
933511167 2:83244064-83244086 AAGCTGGAAACCATCATTCTCGG + Intergenic
933619445 2:84520691-84520713 GAGCTTGAGGTCATCATCCTTGG - Intronic
933935984 2:87204156-87204178 GAGTGGGAGGCCTTCATTCTTGG + Intergenic
935094100 2:99927439-99927461 GAGCTGGAGGCCATTATCCTAGG + Intronic
936091144 2:109502069-109502091 GCGCTGGAGATCATCTTTCTGGG + Intronic
936357163 2:111761673-111761695 GAGTGGGAGGCCTTCATTCTTGG - Intergenic
936403069 2:112181047-112181069 GAGCTGGAGGCTACCATCCTTGG + Intronic
937419621 2:121742842-121742864 GAACTGGAGGCCATCATCCTAGG + Intronic
938326858 2:130412786-130412808 AAACTGGAAGCCATCATCCTTGG + Intergenic
938363086 2:130708673-130708695 AAACTGGAAGCCATCATCCTTGG - Intergenic
938395038 2:130939184-130939206 CAACTGGAGGCCATTATCCTAGG - Intronic
938439465 2:131315287-131315309 AAACTGGAAGCCATCATCCTTGG - Intronic
938441796 2:131341760-131341782 AAACTGGAAGCCATCATTCTCGG - Intronic
938811332 2:134855604-134855626 GAGCTGAAGCACATCAATCTTGG + Intronic
938939446 2:136156424-136156446 GGCCTGGATGCCATCTTTCTTGG - Intergenic
939047640 2:137268432-137268454 AAGCTGGAAACCATCATTCTCGG - Intronic
939831116 2:147072074-147072096 GAACTGGAGGCGATTATTTTAGG - Intergenic
940036611 2:149318684-149318706 AAGCTAGAAACCATCATTCTCGG - Intergenic
940362106 2:152806742-152806764 CAGCTAGAGGCCATTATCCTAGG - Intergenic
940365835 2:152847750-152847772 GAGCTGGATGCCATTATTCTAGG - Intergenic
940383984 2:153048942-153048964 CAGCTGGAGGCCATTATCCTCGG + Intergenic
941050065 2:160722629-160722651 AAGCTGAAAGCCATCATCCTTGG - Intergenic
941131324 2:161653130-161653152 AAGCTGGAAACCATCATTCTCGG - Intronic
941304559 2:163846483-163846505 CAGCTGGAGGTCATCATTCTGGG + Intergenic
941345279 2:164361238-164361260 AAGCTGGAAACTATCATTCTCGG + Intergenic
941426082 2:165347304-165347326 AAGCTGGAAACCATTATTCTCGG + Intronic
942280633 2:174359922-174359944 AAGCTGGAAACCATCATTCTGGG + Intronic
942696956 2:178657126-178657148 AAACTGGAAACCATCATTCTTGG + Intronic
942697395 2:178661387-178661409 AAACTGGAAACCATCATTCTTGG + Intronic
942741944 2:179191288-179191310 CAGCCAGAGGCCATCATCCTAGG + Intronic
942805034 2:179920416-179920438 GAGCTAGATGCCATTATCCTAGG - Intergenic
943046773 2:182869418-182869440 GAGCTGGAGGCCATTATACTAGG - Intergenic
943194218 2:184721944-184721966 GAGCTGGAGGGCATTATGTTAGG + Intronic
943629735 2:190237949-190237971 AAGCTGGAAACCATCATTCTCGG - Intronic
943795411 2:191986910-191986932 GAGCTGGTGATCTTCATTCTGGG + Intronic
944026361 2:195173681-195173703 GAGCTGGAGGCTATCATCCTAGG + Intergenic
944596372 2:201265201-201265223 GAGCTGGAGGCCATTATTCTAGG + Intronic
944788568 2:203100025-203100047 GAGCTGGAGGCCATTATTCTAGG - Intronic
944845612 2:203664921-203664943 AAGCTGGAAGCCATCATCCTTGG - Intergenic
945023814 2:205600783-205600805 GAGCTGGAAGCCATTAGCCTCGG - Intronic
945058782 2:205890574-205890596 CAGCTGAAGGCCATTATTCTAGG + Intergenic
945329152 2:208519524-208519546 AAGCTGGAAACCATCATTCTCGG - Intronic
945377469 2:209096282-209096304 GAGCTGGAGGCCATTATCCCTGG - Intergenic
945659933 2:212673436-212673458 GAGCTAGAGGCCATAATCCTAGG - Intergenic
946507635 2:220318502-220318524 CAGGTGGGGGCCATCATGCTTGG - Intergenic
947020996 2:225675425-225675447 ATGCTGGAGGCCATTATCCTAGG - Intergenic
947281052 2:228455251-228455273 GAGCTGGAGGCTGTTATCCTAGG - Intergenic
947459239 2:230288748-230288770 AAGCTGGAAACCATCATTCTGGG - Intronic
948181511 2:235984731-235984753 AAGCTGGAAGCCATCTTCCTCGG - Intronic
1169311092 20:4540693-4540715 GGCCTGGAGGCCTTGATTCTAGG - Intergenic
1169426061 20:5498215-5498237 GAGTGGGTGGCCATCACTCTGGG - Intergenic
1169849463 20:10034094-10034116 GAGCTGGAGGCAATTATCCTTGG - Intronic
1169991452 20:11508011-11508033 GAGCTAGAGGCCATTATTCTAGG + Intergenic
1170228848 20:14022723-14022745 AAGCTGGAAACCATCAATCTCGG - Intronic
1170484043 20:16797305-16797327 GAACTGGAGGCCATTATCCTTGG - Intergenic
1171115375 20:22520769-22520791 AAGCAGGAGGCCATAATTCTGGG + Intergenic
1172437748 20:34942080-34942102 GAGCTGGAGCCCCTTACTCTGGG + Intronic
1173028329 20:39330572-39330594 TACCTGGAGGCCATCAATTTGGG + Intergenic
1173440434 20:43070687-43070709 AAGCTGGAAACCATCATTCTCGG + Intronic
1173508751 20:43609375-43609397 GAGATGGATGGCATAATTCTGGG + Intronic
1173566672 20:44044139-44044161 AAGCTGGAAACCATCATTCTTGG + Intronic
1174736463 20:52970673-52970695 GAGCTGGAGGCCGTTATTCTAGG + Intergenic
1174796118 20:53523844-53523866 AAGCTGGAAACCATCATCCTTGG + Intergenic
1174853624 20:54021592-54021614 GAGCTGGAAGCCATTATCTTTGG + Intronic
1174964365 20:55194708-55194730 CAGCTGGAGGCCATTATCCTAGG + Intergenic
1175364702 20:58444617-58444639 GAGCTGGAGCCCAGCATGCTGGG + Exonic
1175371843 20:58497433-58497455 CTGCTGGAGGCCATGAGTCTGGG + Intronic
1175591497 20:60195700-60195722 GAGCTGGAAGCCATTATCCATGG - Intergenic
1176360198 21:5988815-5988837 CAGCTGGAGGCCATCAGCCAGGG + Intergenic
1176523517 21:7846746-7846768 AAGCTGGAAACCATCATTCTCGG + Intergenic
1176583478 21:8551166-8551188 GACCTGGAGGCCCACACTCTTGG + Intergenic
1176946878 21:14992596-14992618 GAGCGGGAGGACATCTTACTTGG - Intronic
1176994021 21:15532886-15532908 GAGCTGGAGGAGAGCATTTTGGG - Intergenic
1177506874 21:22030682-22030704 AAGCTGGAAACCATCGTTCTCGG + Intergenic
1177551812 21:22632778-22632800 AAGCTGGAGGCCATTATCCTAGG + Intergenic
1177690912 21:24506148-24506170 GAACTGAAGGCCATTATCCTTGG - Intergenic
1177717672 21:24860794-24860816 GAGCTGGAGGCCATTGTCGTTGG + Intergenic
1177758791 21:25379322-25379344 GAGCTGGAGGCTATTATCCTAGG + Intergenic
1177764851 21:25445892-25445914 GAGCTGGAGGATATTATCCTAGG + Intergenic
1178019295 21:28391303-28391325 GAGCTGGAGACCATTATCCTTGG + Intergenic
1178296765 21:31416601-31416623 GAGCTGGAGGCCATTATTCTAGG - Intronic
1178657537 21:34476758-34476780 AAGCTGGAAACCATCATTCTCGG + Intergenic
1179763320 21:43549735-43549757 CAGCTGGAGGCCATCAGCCAGGG - Intronic
1179902334 21:44400641-44400663 GAGCAGGAGACCATCTTTCCTGG - Intronic
1180266288 22:10528097-10528119 GACCTGGAGGCCCACACTCTTGG + Intergenic
1180375506 22:12089256-12089278 AAGCTGGAAACCATCATTCTCGG + Intergenic
1180459453 22:15547875-15547897 AAACTGGAAGCCATCATCCTCGG - Intergenic
1180700758 22:17780427-17780449 GAGCTGGAGGCCAGCTTTTCTGG - Intergenic
1180734870 22:18008645-18008667 GAGCTCGAAGACATCATTCTAGG + Intronic
1183270644 22:36860678-36860700 AAAATGGAGGCCAGCATTCTAGG + Intergenic
1183366019 22:37407276-37407298 GAGCTGGAGGGCACGATTTTTGG + Intronic
1184152081 22:42645137-42645159 GGGTTGGAGGCCAGCATTCGGGG - Intronic
949780199 3:7677944-7677966 GAACTGTAGGCCATTTTTCTAGG + Intronic
951189663 3:19753614-19753636 AAGCTGGAAACCATCATTCTCGG + Intergenic
951567600 3:24026798-24026820 AAGCTGGAAACCATCATCCTCGG - Intergenic
952618097 3:35300021-35300043 GAGCTGGAGGCCATTATTCTAGG - Intergenic
952695626 3:36262298-36262320 GAGCTGGAGGCCCTTAGCCTTGG - Intergenic
953269734 3:41429601-41429623 GAGCTGGAAGCCATTATCCTCGG + Intronic
953300074 3:41765270-41765292 AAGCTGGAAACCATCATTCTGGG + Intronic
953807574 3:46084654-46084676 TAGCTGGAGGCCATTATCCTAGG + Intergenic
954092362 3:48295187-48295209 GAGCTGGATGGCATCCTTGTGGG + Exonic
954540366 3:51389632-51389654 GAGCTGGAGGCCACAGCTCTAGG + Intergenic
955444372 3:58993711-58993733 TAGCTGGAAGCCATTATCCTCGG - Intronic
955444720 3:58997534-58997556 GAGCTTGAGGCCATCATTAGAGG - Intronic
955898160 3:63723190-63723212 GAGTTGGAAGCCATTATCCTCGG + Intergenic
956541037 3:70340116-70340138 AAGCTGGAAACCATCATTTTGGG + Intergenic
957578552 3:82040481-82040503 AAGCTGGAAACCATCATTCTCGG + Intergenic
957657631 3:83101599-83101621 AAGCTGGAAACCATCATTCTTGG + Intergenic
957872009 3:86101251-86101273 GAGCTGGAAGCCATTATCCTTGG - Intergenic
958512589 3:95067433-95067455 GAGCTGGAGGCCATCATCCTAGG + Intergenic
958998800 3:100938007-100938029 GAGCTGGAGGCCATTATCCTTGG + Intronic
959256702 3:104024385-104024407 GAGCTGGGAGCCATTATCCTCGG + Intergenic
959365890 3:105457179-105457201 GAGCTGGAGGCCATTATTCTTGG - Intronic
959588286 3:108046979-108047001 GACCTGAAAGGCATCATTCTTGG + Intronic
960468092 3:118023871-118023893 GAACTGGAGGCCATTATTCTAGG - Intergenic
960721715 3:120630942-120630964 GAGCTGGAGGCCATTATCCTTGG + Intronic
960736338 3:120785083-120785105 GAGCTGGAGGCCATTATCCCAGG - Intergenic
960951603 3:123002178-123002200 AGTCTGGAGGGCATCATTCTTGG + Intronic
961494293 3:127279831-127279853 GAGCTGGAGGCCATTATCCTTGG + Intergenic
962179543 3:133191517-133191539 GAGCTGAAGCCCATCCTTGTTGG - Intronic
962610284 3:137070114-137070136 AAGCTGGAAACCATCATTCTCGG - Intergenic
963117158 3:141739891-141739913 TAGCTGGAGGCCACCATGCCTGG - Intronic
963176189 3:142299945-142299967 TAGATGGAGGCCATTATCCTAGG - Intergenic
963407327 3:144882812-144882834 GAGCTGGAGGCTCTTATCCTTGG + Intergenic
963490201 3:145990286-145990308 GAGCTGGAGGCCATTATCCTAGG + Intergenic
963514176 3:146288173-146288195 AAGCTAGAAACCATCATTCTGGG - Intergenic
963525335 3:146409019-146409041 GAGCTGTTGGCAATCATCCTAGG + Intronic
963614017 3:147511544-147511566 AAGTTGGAAACCATCATTCTCGG - Intergenic
963820269 3:149883980-149884002 GAGCTGGATGCCGTTATCCTTGG - Intronic
963980866 3:151535320-151535342 CAGCTGGAGGCTATTATCCTAGG + Intergenic
964022335 3:152028162-152028184 GAACTGGAGGCCATTATCCTAGG + Intergenic
964024724 3:152058462-152058484 GAGCTGGAGGCCATTATCCTAGG - Intergenic
964156872 3:153596227-153596249 AAGCTGGAAACCATCATTCTCGG - Intergenic
964242364 3:154611370-154611392 CAGCTGGAGGCCATTATCTTAGG - Intergenic
964284181 3:155099678-155099700 AAGCTGGAAACCATCATTCTCGG - Intronic
964414830 3:156436198-156436220 GAGCTGGAAGCCATCATCCTTGG - Intronic
964703518 3:159594232-159594254 AAGCTGGAGGCCAGCATTGATGG + Intronic
965132544 3:164720153-164720175 GAGCTGGAGGCCATTATTCTTGG - Intergenic
965229527 3:166032619-166032641 CAGATAGAGGCCATCATCCTAGG - Intergenic
965253010 3:166367365-166367387 GATCTTTAGGCCATCATACTTGG - Intergenic
965334422 3:167418552-167418574 AAGCTGGAAACCATCATCCTCGG - Intergenic
965508096 3:169538115-169538137 GTGCTGGAAGCCATTATTCTTGG + Intronic
965645140 3:170872194-170872216 CAGCTGGAGGCCATTATCCTAGG - Intergenic
965790449 3:172381749-172381771 GAAGTGGAAACCATCATTCTTGG - Intronic
965916058 3:173847459-173847481 TAGCTGGTAGCCATCATTGTTGG - Intronic
967052971 3:185801878-185801900 AAGCTGGAAGCCATCATTCTCGG + Intronic
967280471 3:187817540-187817562 CAGCTGGAGGCCATTATCCTGGG - Intergenic
967549231 3:190770350-190770372 GAACTGGAGACTATTATTCTAGG - Intergenic
967699665 3:192576919-192576941 AAGCTGGTAACCATCATTCTTGG + Intronic
968133103 3:196203654-196203676 GATCAGGAGGGCAGCATTCTGGG + Intronic
968183690 3:196616152-196616174 GAGCTGGAGGCCATTATCCTAGG - Intergenic
968532022 4:1097138-1097160 GGGCTGGAGGCCTTCATTCATGG - Intronic
970025735 4:11622212-11622234 GAGCTGGAGGCCCAGTTTCTGGG + Intergenic
970170566 4:13285081-13285103 CAGCAGGAGGCCATTATGCTAGG - Intergenic
970292247 4:14585945-14585967 GAGCTGGAGGCCATTATCCTTGG + Intergenic
970871523 4:20821761-20821783 GAGTTGGAGGCCATTTTTCTAGG - Intronic
970875356 4:20862830-20862852 GAGCTGGAGGCCATTATCCTTGG + Intronic
970908044 4:21240086-21240108 AAGCTGGAAACCATCATTCTTGG + Intronic
971187040 4:24388681-24388703 AATCTGGAAGCCATCATTCTCGG + Intergenic
971359371 4:25922672-25922694 GGGCAGAAGCCCATCATTCTTGG + Intronic
971537109 4:27767301-27767323 GAGCTGGAGGCCATTATTCTAGG + Intergenic
971628573 4:28958303-28958325 AAACTGGAAACCATCATTCTTGG - Intergenic
971710253 4:30101912-30101934 AAGCAGAAGGCCATTATTCTGGG - Intergenic
971747843 4:30607529-30607551 GAGCTGGAGGCCATGATCGTTGG - Intergenic
971816656 4:31499367-31499389 AAGCTGGAAACTATCATTCTCGG - Intergenic
972150986 4:36090622-36090644 GAACTGGAGGCCATTATCGTTGG + Intronic
972407449 4:38760410-38760432 GAATTGGAGACCATTATTCTAGG - Intergenic
972724659 4:41736226-41736248 GAGCTGGAGGCCATTATCCTAGG - Intergenic
973047085 4:45548120-45548142 CAGCTGGAGGCCATTACCCTAGG + Intergenic
973062469 4:45744714-45744736 GAGCTGGAAGCCATCATCCTCGG - Intergenic
973129329 4:46630729-46630751 GAGCTGGAGGCCATTATCCTAGG - Intergenic
973561502 4:52141421-52141443 CAGCTGGAGGCCATTAACCTTGG + Intergenic
973674832 4:53253954-53253976 GAGCTGGAGGTCATTATCCTTGG + Intronic
974077427 4:57180102-57180124 AAGCTGGAAACCATCATTCTGGG - Intergenic
974668588 4:64998750-64998772 AAGTTGGAGGCCATCATTCTTGG + Intergenic
974741087 4:66008833-66008855 AAGCTGGAAGCCACCATCCTCGG - Intergenic
974780893 4:66550963-66550985 GAACTGGAAACCATCATTCTCGG + Intergenic
975093430 4:70429460-70429482 GAGCTGGAAGCCATTATCCTTGG + Intergenic
975158407 4:71097304-71097326 GATCTGGAGGCCATTATCATTGG - Intergenic
975163338 4:71148677-71148699 GAGCTGGAGGCCATTATCCTTGG - Intergenic
975403028 4:73959203-73959225 GAACTGAAGGCCATTATCCTTGG - Intergenic
975809946 4:78157104-78157126 CAGCTGGAGGCCATTGTCCTAGG - Intronic
975894674 4:79074605-79074627 GAGCTGGAGGCTATTATCCTTGG + Intergenic
975896602 4:79099943-79099965 GAGATGGAGGCCATTATCTTAGG - Intergenic
976793391 4:88905685-88905707 GAGCTGGAGGCTATCATGCTTGG - Intronic
976998763 4:91468214-91468236 AAGCTGGAAACCATCATTCTTGG + Intronic
977145459 4:93434294-93434316 AAGCTGGAAACCATTATTCTCGG - Intronic
977469497 4:97424991-97425013 AAGCTGGAAACCATCATTCTGGG - Intronic
977671923 4:99704906-99704928 AAGCTGGAAACCATCATTCTCGG + Intergenic
978028908 4:103914248-103914270 GAGCTGGAAGTCATTATCCTTGG - Intergenic
978319813 4:107481386-107481408 GAGGTGGTGGGCATCATACTGGG + Intergenic
978338511 4:107696435-107696457 GAGCTGGAAGCCATCATCCTCGG + Intronic
978476802 4:109139952-109139974 AAGCTGGAAACCATCATTCTCGG - Intronic
978912115 4:114076449-114076471 CAGCTGGAGGTCATTATCCTAGG + Intergenic
979012817 4:115393023-115393045 AAGCTGGAAACCATCATCCTCGG + Intergenic
979043110 4:115825032-115825054 GAACTGGAGGACATTATCCTAGG - Intergenic
979050926 4:115931550-115931572 GAGCTGGAGGTTATTATCCTAGG - Intergenic
979208493 4:118071541-118071563 GAGCTGGAGGCCATTATCCTAGG - Intronic
979390703 4:120123949-120123971 TAGCTGGAGTCCCTTATTCTAGG - Intergenic
980296222 4:130921597-130921619 CAGCTGGAGGCCATTATCCCAGG - Intergenic
980364114 4:131776791-131776813 AAGCTGGAAGCCATCATTCTCGG - Intergenic
980553527 4:134371678-134371700 GAGATGGAGGTCATAATCCTAGG - Intergenic
980647003 4:135654694-135654716 AAGCTGGAAACCATCATTCTCGG + Intergenic
980684911 4:136214749-136214771 GAGCTGGAGGCCATTATTCTAGG - Intergenic
981126822 4:141116853-141116875 AAGCTGGAAACCATTATTCTCGG + Intronic
981361601 4:143852190-143852212 GAGCTGGAGGCCATTATTCTAGG - Intergenic
981372337 4:143973172-143973194 GAGCTGGAGGCCATTGTTCTAGG - Intergenic
981381421 4:144076371-144076393 GAGCTGGAGGCCATTATTCTAGG - Intergenic
981586837 4:146312704-146312726 GAACTGGAGGACATTATGCTAGG - Intronic
982039450 4:151381284-151381306 GAACTGGAGGCCATTATCTTAGG + Intergenic
982120960 4:152143385-152143407 AAGCTGGAAACCATCATTCCCGG + Intergenic
982288250 4:153756874-153756896 GAGATGGAGGCCAGCATGCAGGG + Intronic
982462807 4:155692074-155692096 GAGCTGGAGGCCATTATCCTGGG - Intronic
983195070 4:164798014-164798036 GAACTGGAGGCCATTATCCTAGG - Intergenic
983663731 4:170158568-170158590 AAGTTGGAGACCATTATTCTAGG - Intergenic
983833338 4:172359243-172359265 GAGCTGGAGGCCATTATCCTTGG + Intronic
984037666 4:174690789-174690811 GAGCTGGAGGCTATTATCCTTGG - Intronic
984141834 4:176013191-176013213 CAGCTGGAGGCCATTATACTAGG - Intergenic
984438673 4:179737070-179737092 AAGCTGGAAACCATCATTCTGGG + Intergenic
984485135 4:180358645-180358667 AAGCTGGAGACCATCATTCTAGG - Intergenic
985356258 4:189122760-189122782 GAATTGGAGACCATTATTCTGGG + Intergenic
1202757103 4_GL000008v2_random:74698-74720 AAGCTGGAAACCATCATTCTCGG + Intergenic
985932710 5:3071235-3071257 GAACTGGAGGCCATTACCCTTGG - Intergenic
985948854 5:3207575-3207597 GAGGTGGGGGCCATTATCCTTGG - Intergenic
986193149 5:5515475-5515497 GAGCTGGAGACCATAATCCTAGG + Intergenic
986966903 5:13284536-13284558 GTGCTGGAGGCGATGATGCTGGG + Intergenic
987052935 5:14163299-14163321 AAGTGGGAAGCCATCATTCTTGG - Intronic
987223394 5:15814289-15814311 AAGCTGGCAACCATCATTCTCGG + Intronic
987287834 5:16476612-16476634 GAGCTGGAAGCCATTATCCTCGG + Intronic
987290508 5:16504183-16504205 GAGCTGGAAGCCGTTATCCTCGG - Intronic
987300427 5:16592755-16592777 GAGCTAGAGGCCATTATCCTTGG + Intronic
987454408 5:18125194-18125216 AAGCTAGAAGCCATCATTCTTGG + Intergenic
987744824 5:21957204-21957226 GAGCTGGAGGCTATTATACTGGG - Intronic
987748195 5:22004925-22004947 GAGCTGGAGGCCATTATCTTGGG - Intronic
988097979 5:26642337-26642359 AAGCTGGAGGCCATTATCCTTGG + Intergenic
988328113 5:29797793-29797815 AAGCTGGAAACCATCATTCTCGG - Intergenic
988332178 5:29856216-29856238 AAGCTGGAAACCATCATTCTTGG - Intergenic
988881377 5:35507285-35507307 GAGCTGGAGGCTGTTATCCTCGG - Intergenic
989041810 5:37237308-37237330 GAACTGGAGGTCATTATCCTAGG + Intronic
989126961 5:38064035-38064057 GAGCTAGAAGCCATTATCCTTGG - Intergenic
989202275 5:38775434-38775456 GAGCTGGAAGCCATTATCCTCGG + Intergenic
989312288 5:40034153-40034175 GAGCTGGAAGCCATTATCCTTGG + Intergenic
989407765 5:41080422-41080444 GAGCTGGAGGCCCTTATTGAAGG - Intergenic
989552276 5:42749912-42749934 AAGCTGGAAACCATCATTCTCGG - Intergenic
989559545 5:42835594-42835616 GAGCTGGAGGCCATTATCCTTGG + Intronic
989685519 5:44081988-44082010 AAGCTGGAAATCATCATTCTCGG - Intergenic
989843127 5:46106555-46106577 AAGCTGGAAACCATCATTCTCGG - Intergenic
990641818 5:57794083-57794105 GAACTGGAGGCCATAATCCGAGG - Intergenic
990713591 5:58611035-58611057 GAGCTGGAGGCCATTATTCTTGG - Intronic
990940071 5:61193267-61193289 GAGCTAGAGGCCATTATTCTAGG - Intergenic
991018972 5:61960309-61960331 CAGCTGGAGGCAAGCATCCTGGG - Intergenic
991419248 5:66424570-66424592 GAACTGGAGACTATTATTCTAGG - Intergenic
991521934 5:67509653-67509675 GAGCTGGACACCATTATCCTAGG + Intergenic
991623477 5:68571453-68571475 GAATTGGAGACCATTATTCTAGG + Intergenic
991765030 5:69967334-69967356 GAGCTGGAGGCTATTATACTGGG - Intergenic
991768367 5:70014712-70014734 GAGCTGGAGGCCATTATCTTGGG - Intergenic
991782295 5:70150819-70150841 GAGCTGGAGGCTATTATACTGGG + Intergenic
991844262 5:70842405-70842427 GAGCTGGAGGCTATTATACTGGG - Intergenic
991847605 5:70889794-70889816 GAGCTGGAGGCCATTATCTTGGG - Intergenic
992239867 5:74756756-74756778 GAACTGGAGACCACTATTCTCGG + Intronic
992340891 5:75822478-75822500 AAGCTGGAAACCATCATTCTCGG + Intergenic
992419374 5:76586834-76586856 CATCTGGAAGCCACCATTCTTGG + Intronic
992505430 5:77382717-77382739 AAGCTGGAAACCATCATTATTGG - Intronic
993696677 5:91069969-91069991 TGGATGGAGGCCATTATTCTAGG + Intronic
993713855 5:91254883-91254905 AAGCTGGAAGCAAACATTCTGGG + Intergenic
993791224 5:92213927-92213949 GAGCTGGAGGCCATTATACGTGG - Intergenic
994079023 5:95685531-95685553 GAGCTGGAGGACATAGTACTGGG - Intronic
994149247 5:96429735-96429757 GAGCTGGAGGCCATTATTGTTGG - Intronic
994271105 5:97778104-97778126 AAGCTGGAAGCCATTATTCTCGG + Intergenic
994299284 5:98127240-98127262 GAGCTGGAAGCCGTTATCCTCGG + Intergenic
994345923 5:98686101-98686123 AAACTGGAAGCCATCATTCTCGG + Intergenic
994456622 5:100016897-100016919 GGGCTGGAGACCAGCAGTCTGGG - Intergenic
994868145 5:105305676-105305698 CAGCTGGAGGCCATTATGCTAGG - Intergenic
995887099 5:116907626-116907648 GAGCTGGAGGCCATTATCCTTGG - Intergenic
995912950 5:117209623-117209645 GAGCTGGAGGCCATTATCCTTGG - Intergenic
996700388 5:126444976-126444998 GAGCTGGAAGCCATCATTCTCGG - Intronic
996968002 5:129328756-129328778 AAGCTGGAAACCATCATTCTTGG - Intergenic
997287747 5:132694260-132694282 CAGCTGTATGCCATCATGCTCGG - Exonic
998329009 5:141306896-141306918 GAGCTGGGGGCTGTTATTCTAGG + Intergenic
998558870 5:143152608-143152630 GAGCTGGAGCCCTTGAATCTAGG + Intronic
998873110 5:146572538-146572560 AAGCTGGAAGCCATTATTCTCGG + Intergenic
998912721 5:146977654-146977676 AAGCTGGAGACCATCATTCTCGG - Intronic
998917936 5:147036294-147036316 GAGCTGGAGGCCATTATCCTTGG - Intronic
999469310 5:151837672-151837694 AAGCTGGAAACCATTATTCTCGG + Intronic
1000668118 5:164024307-164024329 GAACTGGACGCCATTATCCTTGG - Intergenic
1000756492 5:165167473-165167495 AAGCTGGAAACCATCATTCTGGG - Intergenic
1000786950 5:165556616-165556638 GAGCTAGAGGCCATTATCCTTGG + Intergenic
1000812336 5:165878340-165878362 AAACTGGAAACCATCATTCTCGG - Intergenic
1000992534 5:167925815-167925837 GAGCTGAAGGCCATTATCCTTGG + Intronic
1001340265 5:170837079-170837101 GACCTGGCTGCCAGCATTCTGGG + Intergenic
1001703820 5:173727397-173727419 AAGCTGGAGGCCATTATTGTAGG + Intergenic
1001748927 5:174112959-174112981 GAGCTGGAGGCCATCATTCTCGG - Intronic
1001789393 5:174442942-174442964 AAGCTGGAAGCCATCATCCTTGG + Intergenic
1002400228 5:178987519-178987541 GACCTGGAGGACATGATGCTCGG + Intronic
1003230868 6:4252682-4252704 AAACTGGAAACCATCATTCTTGG + Intergenic
1003554357 6:7126724-7126746 GATTAGGAGGCCAGCATTCTGGG + Intronic
1003667621 6:8126495-8126517 TAGCTGGAGGCCATTATCCTAGG + Intergenic
1004032405 6:11883724-11883746 AAGCTGGAAACCATCATTCTGGG + Intergenic
1004442527 6:15667529-15667551 AAGCTGGAAACCATTATTCTCGG + Intergenic
1005096922 6:22126601-22126623 CAGCTGGAGGCCATTACCCTAGG - Intergenic
1005102089 6:22182228-22182250 GAGCTGGAGGCTATCATCCTTGG - Intergenic
1005120504 6:22384277-22384299 AAGCTGGAAGCCATCATCCTTGG - Intergenic
1005378809 6:25213058-25213080 AAGCTGGAAACCATCATTCTCGG + Intergenic
1005948991 6:30617236-30617258 GAGCGGGCGGCCGCCATTCTGGG - Exonic
1006207288 6:32358693-32358715 AAGCTGGAAACCATCATTCTCGG - Intronic
1006265276 6:32916392-32916414 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1006338492 6:33433080-33433102 GGGCTAGAGCCCATCCTTCTTGG - Intronic
1007049875 6:38816365-38816387 GAGCCGGAAGCCATTATCCTTGG - Intronic
1007068952 6:39020797-39020819 AAGCTGGAAGCCATCATCCTCGG - Intronic
1007182659 6:39941607-39941629 GAGTTGGGGCCCATCCTTCTTGG - Intergenic
1007206522 6:40156763-40156785 GAGCTGGAGGCCATAACCCTAGG + Intergenic
1007289298 6:40773169-40773191 GAGCTGGTAGCCAGCAGTCTTGG - Intergenic
1007561129 6:42809217-42809239 AAGCTGGAAACCATCATTCTCGG - Intronic
1007812959 6:44499262-44499284 GAGCTGGTCTCCATCTTTCTTGG + Intergenic
1008243755 6:49145382-49145404 AAGCTGGAAGCCATCATTCTGGG - Intergenic
1008245929 6:49172727-49172749 GAAATGGAGGCCATTACTCTAGG - Intergenic
1008338475 6:50335748-50335770 GAGTTGGAGATCATTATTCTAGG + Intergenic
1008729259 6:54460123-54460145 AAGCTGGAAACCATCATTCTCGG + Intergenic
1009039334 6:58158250-58158272 CAGCTCGAGGCCTTCACTCTTGG - Intergenic
1009288967 6:61860500-61860522 CAGCTGGAGGCTATTATCCTTGG - Intronic
1009362640 6:62834515-62834537 GAGCTGGAGGCCATTATCTTAGG - Intergenic
1009402839 6:63276709-63276731 CAGCTGGGAGCCATCATACTAGG - Intronic
1009539946 6:64941739-64941761 TAGCTTGAGGCCATTATTCTAGG - Intronic
1010274522 6:73953652-73953674 GAGCTGGAGACCATTACTCTAGG - Intergenic
1010369585 6:75092061-75092083 AAGCTGGAAACCATCATTCTCGG + Intronic
1010423136 6:75696798-75696820 GAGCTAGATGCCATCACTATTGG - Intronic
1010596667 6:77771648-77771670 GAACTGGAGACCATTATCCTTGG + Intronic
1011160333 6:84382177-84382199 GAGTTGGAGGCCATTATTCTAGG - Intergenic
1011362531 6:86543237-86543259 CAGTTGGGGGCCATCATTCTAGG + Intergenic
1011399807 6:86948162-86948184 AAGCTGGAAGCCATCATTCTCGG - Intronic
1011537280 6:88390128-88390150 AAGCTGGAAACCATCATTCTTGG + Intergenic
1011576557 6:88806952-88806974 GAGCTGGAAGCCATTATCCTCGG + Intronic
1011614266 6:89183724-89183746 GAACTGGAGGCCATTATTCTAGG + Intronic
1011851147 6:91630196-91630218 GAGCTGGAAGCCATTATCCTCGG - Intergenic
1012036939 6:94154414-94154436 AAGCTAGATGCCATAATTCTAGG + Intergenic
1012161895 6:95895495-95895517 AAGCTGGAGGCCATTATCCTTGG - Intergenic
1012666076 6:101971876-101971898 CAGCTGGAGGCCATAATCCTCGG - Intronic
1012772833 6:103461551-103461573 AAGCTGGAAACCATCATTATCGG + Intergenic
1012787331 6:103647569-103647591 AAGCTGGAAACCATCATTCTCGG + Intergenic
1013334566 6:109142323-109142345 GAGCTGGAAGCCATCATCCTTGG + Intronic
1013393241 6:109708259-109708281 GAGCTGGAGGCCATTATCCTTGG - Intronic
1013879881 6:114884380-114884402 GAGCTGGAGGCCATTATCCCAGG + Intergenic
1014493792 6:122094186-122094208 GAGCTGAAGGCCATTATTCCAGG + Intergenic
1014587850 6:123223149-123223171 TAGCTGGAGGTCATTATCCTTGG + Intronic
1014872011 6:126608550-126608572 CAGCTGGAGGCTATAATTCTAGG - Intergenic
1015368079 6:132419837-132419859 GAGCTGGAAGCCATTATCCTCGG - Intergenic
1015808646 6:137139565-137139587 GACCTGGAGGACATTATACTAGG + Intergenic
1015846985 6:137531043-137531065 GAGCTAGAAGCCATTATCCTCGG - Intergenic
1016479081 6:144462190-144462212 GAGCTGGAAGCCATTATCCTCGG - Intronic
1016638923 6:146326301-146326323 GAGCTGGAGGCCATTATCCTTGG + Intronic
1016735974 6:147480544-147480566 AAGCTGGAAACCATCATTCTCGG - Intergenic
1016991357 6:149931544-149931566 GAATTGGAGGCCATTATCCTAGG + Intergenic
1016998932 6:149982066-149982088 GAGCTGGAGGCCATTATCCTAGG + Intergenic
1018339221 6:162831787-162831809 GAGCTGGAAGCCATTAACCTTGG - Intronic
1020154204 7:5709069-5709091 GAGCATGAGTCCAGCATTCTAGG - Intronic
1020420258 7:7995613-7995635 AAGCTGGAAACCATCATTCTCGG + Intronic
1020614534 7:10441864-10441886 GAGGTGGAGGCCCTTTTTCTAGG - Intergenic
1020636491 7:10701719-10701741 AAGCTGGAAACCATCATTCTCGG + Intergenic
1020687169 7:11310143-11310165 GAGCTAGAGGCCATTATTCTAGG - Intergenic
1020705031 7:11533602-11533624 AAGCTGGAAGCTATCATCCTTGG + Intronic
1021003954 7:15370183-15370205 CAGCTGGAGGCCATTACTCCAGG - Intronic
1021370493 7:19839202-19839224 GAGCTAGAGGCCATTATCCTAGG - Intergenic
1021413978 7:20360625-20360647 GAATTGGAGGCCATTATCCTAGG - Intronic
1021430710 7:20555822-20555844 AAGGTGGAAACCATCATTCTGGG + Intergenic
1021432139 7:20572186-20572208 GAGCTGGAAACCATCATTCTGGG + Intergenic
1021494345 7:21257904-21257926 GAGCTGGAGGCTATTATCCTTGG + Intergenic
1021584642 7:22194855-22194877 GAGTTGGAGGCCACCCTGCTGGG - Intronic
1021747260 7:23754778-23754800 AAGCTGGAAGCCATCATCTTCGG - Intronic
1021898983 7:25264337-25264359 GAGCAGCAGGACATCATCCTGGG + Intergenic
1022130574 7:27401031-27401053 AAGCTGGAAACCATCATTCTGGG - Intergenic
1022530016 7:31061241-31061263 AGGCTGGAGGCCATCTCTCTAGG - Intronic
1022621125 7:31985700-31985722 AAGCTGGAAACCATCATTCTCGG - Intronic
1022934941 7:35165100-35165122 AAGCTGGAAACCATCATTCTTGG + Intergenic
1023105089 7:36756051-36756073 GAGCTGCAGGCCATCCTGTTCGG + Intergenic
1023497156 7:40809908-40809930 CAGCTGGAGGCTATTATGCTAGG - Intronic
1023498082 7:40819037-40819059 AAGCTGGAAACCATCATTCTCGG - Intronic
1023568634 7:41549860-41549882 AAGCTGGAAACCATCATTCTTGG - Intergenic
1023619727 7:42057738-42057760 GAGCTAGAGGCCATTATTCTAGG + Intronic
1024408982 7:49016627-49016649 GAGCTGGAGGTTATTATCCTTGG + Intergenic
1024414229 7:49083479-49083501 AAGCTGGAAACCATCATTCTGGG + Intergenic
1024514299 7:50231720-50231742 AAGCTGGAAACCATCATTCTCGG - Intergenic
1024845201 7:53634408-53634430 GAGCTGGAGGCCATTATCTTTGG + Intergenic
1025215855 7:57055628-57055650 GAACTGGAGGCCATAATCCTAGG + Intergenic
1025253285 7:57366116-57366138 GAGGTGGTTGCCATGATTCTTGG - Intergenic
1025626597 7:63228036-63228058 GAACTGGAGGCCATAATCCTAGG + Intergenic
1025655524 7:63515074-63515096 GAACTGGAGGCCATAATCCTAGG - Intergenic
1026068172 7:67094123-67094145 AAGCTGGAGGCCATCATCCTAGG - Intronic
1026190366 7:68120276-68120298 GAACTGGAGGTCATAATCCTAGG + Intergenic
1026251568 7:68675561-68675583 GAGCTGGAGGCCATTATCCTAGG - Intergenic
1026602902 7:71791412-71791434 GTGCTGGAGGCCATGATCCTTGG + Intronic
1026664666 7:72331979-72332001 GAGCTGGAGGCCATTATCCTTGG - Intronic
1026708748 7:72718185-72718207 AAGCTGGAGGCCATCATCCTAGG + Intronic
1027341565 7:77213750-77213772 CAGCTGGAGGCCATTATCCTAGG - Intronic
1027577787 7:79952610-79952632 GAGCTGGAGGTCATTATCTTTGG + Intergenic
1027637629 7:80694837-80694859 AAGCTGGAAACCATCATTCTCGG + Intergenic
1027863951 7:83622692-83622714 GAGCTGGAAGCCATTATCCTCGG + Intronic
1028044216 7:86094906-86094928 CAGCTGTAGGCCATTATCCTTGG + Intergenic
1028115111 7:86988059-86988081 AAGCTGGAAACCATGATTCTGGG + Intronic
1028281478 7:88935139-88935161 GGATTGGAGGCCATTATTCTAGG + Intronic
1028342287 7:89736180-89736202 GAGCTGGAAGCTATCATCCTTGG - Intergenic
1028490129 7:91401833-91401855 GAGTTGGAGACCATTATTCTAGG - Intergenic
1028531111 7:91839716-91839738 AAGCTGGAAACCATCATTCTCGG - Intronic
1028764120 7:94531230-94531252 GAGTTGGAGGACATAATTCATGG + Intronic
1028783170 7:94760760-94760782 AAGCTGGAGCTCATCATTCCTGG + Intergenic
1029004296 7:97191547-97191569 GAGCTGGAAGCCACTATCCTTGG + Intergenic
1029145929 7:98446003-98446025 AAGCTGGAAGCCATTATCCTCGG + Intergenic
1029808708 7:103023835-103023857 GAGTTGGAGACCATTATCCTAGG + Intronic
1029830890 7:103257865-103257887 AAGCTGGAAACCATCATTCTCGG + Intergenic
1029862815 7:103592317-103592339 GAGCTGGAGGCCATTATCCTAGG - Intronic
1030341321 7:108384003-108384025 GAGCTGGAGGCTATTATCCTTGG - Intronic
1030451203 7:109714487-109714509 GAGCTGGCAGCCATTATCCTTGG + Intergenic
1030699989 7:112627557-112627579 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1030731890 7:112999851-112999873 GAGCTGGAGCCCATTATCCTCGG + Intergenic
1031099525 7:117462143-117462165 AAGCTGGAAACCATCATTCTCGG - Intergenic
1031547009 7:123063269-123063291 GAGCTGGAGGCCATTATACTAGG - Intergenic
1031707202 7:124996162-124996184 AAGCTGGAAACCATCATTCTTGG + Intergenic
1032345272 7:131110450-131110472 GAGCTGGAGGCAATGATTCAGGG + Intronic
1032625029 7:133582260-133582282 GAACTGGAGGCCATTACCCTAGG - Intronic
1032960922 7:137033205-137033227 CAGCTGGAGGTCATTATCCTAGG + Intergenic
1032966985 7:137109021-137109043 GAACTGGAGGCCATTATCCTAGG - Intergenic
1033613540 7:142988701-142988723 GAACTGGAGGCTATTATCCTAGG - Intergenic
1033614008 7:142993837-142993859 AAGCTGGAAGCCATCATTCTTGG + Intergenic
1033798623 7:144875974-144875996 GAACTGGAGGTCATTATCCTTGG - Intergenic
1033946764 7:146728108-146728130 GAGACGGAGGACATCTTTCTGGG + Intronic
1034360455 7:150492357-150492379 AAGCTGGAAACCATCATTCTCGG + Intergenic
1034593068 7:152160359-152160381 GGGCTGGAGCCCAGCAATCTTGG + Intronic
1035030260 7:155852274-155852296 GAGCTGGGGTCAATGATTCTAGG - Intergenic
1035975911 8:4311361-4311383 GAGCTGGAGGCCATTATTCTTGG + Intronic
1036056381 8:5259607-5259629 GAGGTGGGGGCCATTATCCTTGG + Intergenic
1036141793 8:6215742-6215764 GATCTGGAGGCCATTGTCCTGGG - Intergenic
1036218713 8:6902624-6902646 GAAGTGCAGGCCACCATTCTTGG + Intergenic
1036405508 8:8451539-8451561 CAACCGGAGGCCATAATTCTAGG + Intergenic
1036556550 8:9864977-9864999 GAGCTGGTGTCCATGACTCTAGG + Intergenic
1037138752 8:15495033-15495055 GAGCTGGAGGCTATTATCCTAGG - Intronic
1037225671 8:16586690-16586712 GAGCTGGAAGCCATTATTCTTGG + Intergenic
1038235307 8:25746998-25747020 CAGCTGGAAGCCATTATCCTAGG - Intergenic
1038592710 8:28854913-28854935 CAGCTGGAGGCCATTATTCTTGG - Intronic
1038592913 8:28857000-28857022 CAACTGGAGGCCATTATTCTTGG - Intronic
1038886765 8:31671086-31671108 GAGCTGGAGGCCACAATCCTAGG - Intronic
1039234419 8:35486343-35486365 GAGCTTAATGCCATCACTCTGGG - Intronic
1039678542 8:39701768-39701790 GAGCTGGAGGCCATTATCCTTGG - Intronic
1039821058 8:41135984-41136006 GAGCTGGAAGCAATTATCCTTGG + Intergenic
1040695573 8:49993686-49993708 AAGCTGGAAGCCATCATTCTTGG - Intronic
1040771588 8:50983863-50983885 AAGCTGGAAACCATCATTCTCGG - Intergenic
1040978115 8:53216316-53216338 GAGCTGGAGGCTGTCCTGCTGGG - Intergenic
1041564201 8:59258097-59258119 AAGCTGGAAACCATCATTCTCGG - Intergenic
1041756904 8:61323922-61323944 GAGCTGGAGGTCATTATCCTTGG - Intronic
1041919777 8:63168724-63168746 GAGCGCGAGGCCCTCATTTTGGG + Exonic
1042460560 8:69060521-69060543 TAGCTGGAGGCCATTATCCTGGG - Intergenic
1042682460 8:71400998-71401020 GAGTTGGAAGCCATTATCCTCGG + Intergenic
1042726197 8:71880023-71880045 AAGTTGGAAACCATCATTCTCGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043269625 8:78315215-78315237 GAGCTGGAGGCCACTATACTTGG - Intergenic
1043433526 8:80216607-80216629 GAGCTGGAGGCTATTATCCTTGG + Intronic
1043607858 8:82024426-82024448 TAGCTGGAGGCCATTATCCTTGG - Intergenic
1043721895 8:83555059-83555081 GAACTGGAGGTCATTATTTTAGG - Intergenic
1043755024 8:83992690-83992712 AAGCTGGAGGCTATTATCCTTGG + Intergenic
1043761038 8:84068634-84068656 GAGCTGGAGGCCATCATCATAGG - Intergenic
1043805152 8:84663112-84663134 GAGCTGGAATCCATTATCCTTGG - Intronic
1044128378 8:88487918-88487940 GAGCTGGAGGCCATTATCCTAGG + Intergenic
1044200086 8:89424537-89424559 GAACTAGAAGCCATCATCCTAGG + Intergenic
1044302250 8:90598340-90598362 GACCTGGAGCCCAGCATTCCAGG - Intergenic
1044856197 8:96478375-96478397 GAACTGGAGGCTATCATCCTTGG + Intergenic
1044940751 8:97340764-97340786 GAGCTAGAAGCCGTTATTCTTGG + Intergenic
1044957910 8:97500680-97500702 GAATTGGAGACCATTATTCTAGG - Intergenic
1045127476 8:99108126-99108148 GAGCTGGAGGGCATTATCCTAGG - Intronic
1045909221 8:107386105-107386127 GAGCTGGAAGCCATTATCCTAGG + Intronic
1045982271 8:108204411-108204433 AAACTGGAGGCCATTATTCTAGG + Intronic
1046889834 8:119410706-119410728 AAGCTAGAAACCATCATTCTGGG - Intergenic
1047472899 8:125196481-125196503 AAGCTGGAAACCATCATTCTTGG - Intronic
1048088543 8:131212082-131212104 GAACTGGAGGCCATTATCCTAGG - Intergenic
1048151525 8:131899905-131899927 GACCTGGAGATCATCCTTCTGGG - Intergenic
1048272393 8:133040046-133040068 GAGCTGGAGGCCCTCACTGCTGG + Exonic
1048668011 8:136686083-136686105 AAGCTGGAGGCCATCATTCTTGG + Intergenic
1049136118 8:140901936-140901958 AAGCTGGAAACCATCATTCTTGG - Intronic
1049321834 8:142000837-142000859 ATGCTGGGGGCCCTCATTCTGGG + Intergenic
1049680176 8:143914692-143914714 GTGGTGGAGGCCCTCATACTAGG + Intergenic
1049777806 8:144414508-144414530 GAGCTGCAGGCCGTCAGTGTGGG + Intronic
1050039700 9:1476226-1476248 GAGCAGGAGGTCATTATCCTCGG - Intergenic
1050175314 9:2864049-2864071 GCACTGGAGGCCATTATCCTTGG + Intergenic
1050503724 9:6325922-6325944 CAGTTGGAGGCCATTATCCTAGG - Intergenic
1050638799 9:7642884-7642906 CAGCTGAAGGCCATTATCCTAGG - Intergenic
1050677062 9:8068114-8068136 CAGCTGGAGGCCATTATCCAAGG - Intergenic
1050870870 9:10568245-10568267 AAGCTGGAAACCATCATTCTTGG - Intronic
1050888803 9:10797287-10797309 AAACTGGAAACCATCATTCTCGG - Intergenic
1050974959 9:11926332-11926354 GAGCTGGAGGCTATTATCCTTGG + Intergenic
1051575255 9:18607856-18607878 AAGCTGGAAACCAACATTCTCGG - Intronic
1051792964 9:20828916-20828938 GAGCTGGAAGTCATTATCCTCGG - Intronic
1052068688 9:24055072-24055094 AAGCTGGAAACCATTATTCTCGG + Intergenic
1052381910 9:27780779-27780801 AAGGTGGAAACCATCATTCTCGG - Intergenic
1052500283 9:29280418-29280440 GAGCTGGAGGTCATAATCCCAGG + Intergenic
1052595526 9:30552699-30552721 GAGCCGGAGGCCATTATTCTAGG - Intergenic
1052607083 9:30718216-30718238 GAGCTAGAGGCCATCATTCTAGG - Intergenic
1053342671 9:37351056-37351078 GAGCTGGAGACCTACATTGTAGG + Intronic
1053561798 9:39203930-39203952 AAGCTGGAAACCATCATTCTGGG + Intronic
1054135320 9:61415022-61415044 AAGCTGGAAACCATCATTCTGGG - Intergenic
1054796229 9:69304775-69304797 CAGCTGGGGGCCATTATCCTAGG - Intergenic
1055148715 9:72968046-72968068 CAGCTGAAAGCCATTATTCTAGG - Intronic
1055226309 9:74001482-74001504 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1055390459 9:75816450-75816472 AAGCTGGAAACCATCATTCTTGG - Intergenic
1055806086 9:80095323-80095345 GTGCAGGAGGCAATAATTCTTGG + Intergenic
1056093678 9:83229394-83229416 GAGCTGGAGGCCATTATCCTAGG - Intergenic
1056106713 9:83354363-83354385 TAGCTGGAAGCCATTATCCTAGG + Intronic
1056295006 9:85183976-85183998 GAACTGGAGGCTATTATCCTTGG - Intergenic
1057345007 9:94242167-94242189 GAGATGGAGGCCATTATCCTTGG - Intergenic
1057756069 9:97836848-97836870 CAGCTGGAGGCTATTATTCTAGG - Intergenic
1057992247 9:99782501-99782523 AAGCTGGAAACCATCATTCTCGG - Intergenic
1058289679 9:103223664-103223686 GAGCTGGAGGCCATTATCCTTGG + Intergenic
1058635816 9:107037417-107037439 CTGCTGGAGGCCCTCAGTCTTGG + Intergenic
1059523037 9:114961849-114961871 CACTTGGAGGCCAACATTCTGGG - Intergenic
1059546684 9:115183050-115183072 AAGCTGTAGCCCATCATTTTGGG - Intronic
1059698666 9:116754090-116754112 AAGCTGGAAACCATTATTCTCGG - Intronic
1059973544 9:119692233-119692255 AAACTGGAGGCCATTATCCTAGG - Intergenic
1060080639 9:120640987-120641009 CAGATGGAGGCCATTATCCTCGG - Intronic
1060450197 9:123730969-123730991 AAGCTGGAAACCATCATTCTCGG + Intronic
1061314968 9:129789522-129789544 GAGTTCGAGACCATCATCCTGGG + Intergenic
1061719915 9:132545219-132545241 GCACAGGAGGCCATCATTCCTGG - Intronic
1061754020 9:132800151-132800173 TCTCTGGAGGCCATCACTCTCGG + Intronic
1062037339 9:134388669-134388691 GAGTTGGTGGCCGCCATTCTGGG + Intronic
1062555206 9:137110718-137110740 AAGCTGGAGGCCACCATCATCGG - Exonic
1062699327 9:137890808-137890830 GAGCTGGAGGCCGTGAGGCTGGG + Intronic
1203537895 Un_KI270743v1:59558-59580 AAGCTGGAAACCATCATTCTCGG + Intergenic
1185711237 X:2305066-2305088 GAGCTAGAAGCCATTATTCTTGG + Intronic
1185749576 X:2600055-2600077 AAGCCGGAAACCATCATTCTCGG + Intergenic
1185843965 X:3419667-3419689 CAGCGGGAGGCCATTATCCTTGG - Intergenic
1185885147 X:3775850-3775872 CATCTGGAGGCCATTATCCTAGG - Intergenic
1186007759 X:5093272-5093294 GAGCTGAAGGCCATTATCCTTGG + Intergenic
1186096464 X:6107831-6107853 TGGCTGGAGGCCATTATCCTAGG - Intronic
1187458597 X:19465401-19465423 CAGCTGGAGACCATCCTTGTGGG + Intronic
1187699430 X:21950725-21950747 ATGCTGGAAGCCATCATTCTAGG - Intronic
1187797642 X:23021807-23021829 CAGCTGGAGGCCATTATCCTAGG - Intergenic
1188036355 X:25321734-25321756 GAGTGGGAGTCCATAATTCTAGG - Intergenic
1188135313 X:26487542-26487564 GAGCTGCAGGCCATTATCCTAGG + Intergenic
1188294453 X:28430613-28430635 AAGCTAGAGGCCATTATCCTTGG - Intergenic
1188573509 X:31617935-31617957 GAGCTGGAGGCCATTATCCTAGG + Intronic
1188676078 X:32941514-32941536 GTGATGGAGGCCATTATCCTAGG + Intronic
1189215114 X:39316418-39316440 AAGCTGAAAACCATCATTCTTGG + Intergenic
1189809506 X:44768210-44768232 GAGCTGGAGGCCATTATCCTAGG + Intergenic
1189845600 X:45133597-45133619 GAACTGGAGGTCATTATGCTAGG - Intergenic
1189938296 X:46092974-46092996 AAGCTGGAAACCATCATTCTTGG + Intergenic
1190315425 X:49147515-49147537 GAGTGGGAGGCCTTCTTTCTTGG + Intergenic
1190419851 X:50218560-50218582 AAGCTGGAAACCATCATTCTAGG - Intronic
1190450174 X:50571591-50571613 AAGCTGGAAACCATCATTCTAGG + Intergenic
1190458956 X:50651861-50651883 AAGCTGGAAACCATCATTCTAGG - Intronic
1190538548 X:51454335-51454357 GAACTGGAGACCATTATTCTTGG + Intergenic
1190605083 X:52133238-52133260 CAGCTGGAGGCCATTATCCTAGG + Intergenic
1190854533 X:54280641-54280663 CAGCTGGAGGCCATTTTCCTAGG + Intronic
1191024682 X:55900846-55900868 AAGCTGGAAACCATCACTCTTGG + Intergenic
1191061058 X:56296799-56296821 AAGCTGGAAATCATCATTCTCGG + Intergenic
1191204913 X:57823406-57823428 GAGCTGAAGTCCATTATCCTAGG + Intergenic
1191878695 X:65822805-65822827 GTGCTGGAGGCCATTATCCTTGG + Intergenic
1191888281 X:65912639-65912661 GAGCTGAAGGCCATTATTATTGG - Intergenic
1191977266 X:66887072-66887094 AAGCTGGAAACCATCATTCTGGG - Intergenic
1191994241 X:67073805-67073827 GAGCTGGAAGCCTTTATCCTTGG + Intergenic
1192228934 X:69250919-69250941 AAGCTGGAAACCATGATTCTCGG + Intergenic
1192287159 X:69750301-69750323 AAGCTGGAAACCATCATTCTGGG - Intronic
1192761770 X:74101391-74101413 AAGCTGGAAACCATCATTCTTGG + Intergenic
1192893877 X:75419811-75419833 AAGCTGGAAACCATCATTCTCGG + Intronic
1192897968 X:75464147-75464169 AAGCTGGAAACCATCATTCTCGG + Intronic
1192901913 X:75508426-75508448 AAGCTGGAAACCATCATTCTCGG - Intronic
1192945395 X:75961467-75961489 AAGCTGGAAACCATCATTCTTGG - Intergenic
1193152890 X:78142878-78142900 GAGCTGAAGGCCATTATCCTTGG - Intergenic
1193268355 X:79499987-79500009 AAGCTGGAAACCATCATTCTCGG + Intergenic
1193308725 X:79979877-79979899 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1193354974 X:80508599-80508621 GAACTGGAGGCCATTATCTTGGG + Intergenic
1193367870 X:80656428-80656450 AAGCTGGAAACCATCATTCTCGG + Intergenic
1193456826 X:81741903-81741925 TAGCTGGAGGCCATCATCACAGG - Intergenic
1193459105 X:81769144-81769166 CAGCTGGAGGCAATTATCCTAGG + Intergenic
1193638377 X:83981548-83981570 GAACTGGAGGCCATTATCTTAGG + Intergenic
1194005505 X:88486638-88486660 AAGCTGGAAGCCATCATTCTCGG - Intergenic
1194089923 X:89573056-89573078 GAAATGGAGGCCATTATTCTAGG - Intergenic
1194239560 X:91427691-91427713 GAACTGGAGACTATTATTCTAGG + Intergenic
1194432569 X:93827938-93827960 GAACTGGAGGCCATTATCTTAGG - Intergenic
1194558520 X:95392968-95392990 AAGCTGGAAACCATCATTCTCGG + Intergenic
1194579081 X:95649105-95649127 AAGCAGGAGGCCATTATCCTGGG + Intergenic
1194594373 X:95838794-95838816 GAGCTGGAGGCCATTATCCTAGG + Intergenic
1194855820 X:98927323-98927345 AAGCTGGAAGTCATCATCCTCGG + Intergenic
1195480758 X:105342021-105342043 AAGCTGGAAACCATCATTCTCGG + Intronic
1195665613 X:107427567-107427589 CAGCTGGAAACCATCATTCTGGG + Intergenic
1195867351 X:109447487-109447509 AAGCTGGAAACCATCATTCTCGG + Intronic
1195901360 X:109801017-109801039 GAGCTGGAGGCCATTGTCCTAGG + Intergenic
1196277407 X:113783225-113783247 AAGCTGGCAACCATCATTCTCGG + Intergenic
1196516637 X:116620882-116620904 CAGCTGGAGGCCATTATCCTGGG - Intergenic
1196524752 X:116719172-116719194 GAGCTGGAGGCCATTATTTAAGG + Intergenic
1196540733 X:116903943-116903965 TAGCTGGAGGCCATTATCCTAGG + Intergenic
1196741071 X:119026584-119026606 GAGCTGGAAGCCATTATCCTTGG + Intergenic
1196993259 X:121351613-121351635 GAACTGGAGGCCATTATTCTTGG + Intergenic
1197123770 X:122920719-122920741 AAGCTGGAAACCATCATTCTCGG + Intergenic
1197377459 X:125698953-125698975 GAGCTGGAGGCCATTATCCTAGG - Intergenic
1197570453 X:128144624-128144646 GAACTGGAGGCCATTATTCTAGG + Intergenic
1198267992 X:135028450-135028472 GAGCTGGAGGCCATTATTCTAGG + Intergenic
1198337796 X:135684494-135684516 GAGCTGGAAGCCGTTATCCTCGG + Intergenic
1199066345 X:143423053-143423075 AAGCCGGAAACCATCATTCTGGG - Intergenic
1199066507 X:143425208-143425230 GAGCTGGAGGCCATTATCCTTGG - Intergenic
1199099732 X:143785071-143785093 AAGCTGGAAGCCATCATCCTCGG + Intergenic
1199245323 X:145598215-145598237 GAGCTGGAAGCCATTATCCTTGG + Intergenic
1199561386 X:149167052-149167074 GAGCTGCAGGCCATTATCCTTGG + Intergenic
1200428608 Y:3049915-3049937 GAGTTGGGGACCATTATTCTGGG - Intergenic
1200442574 Y:3229110-3229132 GAAATGGAGGCCATTATTCTAGG - Intergenic
1200778295 Y:7190297-7190319 AAGCTGGAAACCATTATTCTCGG - Intergenic
1201342430 Y:12948942-12948964 AAGCTGCAAGCCATCATCCTCGG + Intergenic
1201578743 Y:15489007-15489029 AAGCTGGAAACCATCATTCAGGG - Intergenic
1201666740 Y:16466087-16466109 AGGCTGGAGACCATCATTCTGGG + Intergenic
1201709826 Y:16978463-16978485 AAGCTGGAAGACATCATGCTAGG + Intergenic
1201929855 Y:19330978-19331000 AAGCTGGAATCCATCCTTCTTGG - Intergenic