ID: 1001749309

View in Genome Browser
Species Human (GRCh38)
Location 5:174116789-174116811
Sequence GAGGGCTGCGAGGAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 783}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001749309_1001749320 28 Left 1001749309 5:174116789-174116811 CCTCCAGCCTCCTCGCAGCCCTC 0: 1
1: 0
2: 7
3: 69
4: 783
Right 1001749320 5:174116840-174116862 AGCATCACTGACATCTCCACCGG 0: 1
1: 0
2: 2
3: 23
4: 173
1001749309_1001749315 0 Left 1001749309 5:174116789-174116811 CCTCCAGCCTCCTCGCAGCCCTC 0: 1
1: 0
2: 7
3: 69
4: 783
Right 1001749315 5:174116812-174116834 TCCCAGTCTCAGTCTCCTGCCGG 0: 1
1: 0
2: 1
3: 21
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001749309 Original CRISPR GAGGGCTGCGAGGAGGCTGG AGG (reversed) Intronic
900091971 1:924570-924592 GCGGGCAGCGAGGCGGCCGGGGG - Intergenic
900149162 1:1170764-1170786 GAGGGCTGCGGACAGGATGGAGG + Intergenic
900184168 1:1325185-1325207 GGGGGCTGACAGCAGGCTGGGGG - Intronic
900243100 1:1626075-1626097 GATGGCAGGGAGGGGGCTGGAGG + Intronic
900475285 1:2873551-2873573 CAGGCCTGGGCGGAGGCTGGGGG - Intergenic
900655074 1:3752817-3752839 GAGGGCTGCCACGAGCCTTGAGG + Intronic
900783753 1:4634459-4634481 GGAAGCTGAGAGGAGGCTGGTGG - Intergenic
900793335 1:4693365-4693387 GAGGGCTTCCTGGAGGCAGGGGG + Intronic
901055304 1:6446383-6446405 GAGGGCTGGAAGGAGGGTGGGGG + Intronic
901133207 1:6975808-6975830 AAGGGCTGGGAGGAAGTTGGGGG - Intronic
901229040 1:7631782-7631804 GAGGGTAGCCAGGAGGCAGGGGG - Intronic
901685524 1:10941423-10941445 GAGGGCTGTGATGAAGCCGGGGG - Intergenic
901886998 1:12230242-12230264 GAGCGATGCTAGGAGCCTGGGGG + Intronic
901941171 1:12663070-12663092 AAGGGCTTCCAGGAGGCTGCAGG + Intronic
902235068 1:15051989-15052011 GAGTGCTTGGAAGAGGCTGGAGG + Intronic
902628653 1:17691491-17691513 GAGGGAGGCGATGAGGCTTGTGG + Intronic
902798462 1:18814783-18814805 GAGGGCTGATGGGGGGCTGGTGG - Intergenic
902850275 1:19149915-19149937 GAAGGGAGGGAGGAGGCTGGTGG + Intronic
902906694 1:19563554-19563576 TAGAGCTGCCAGGAGCCTGGGGG - Intergenic
902935101 1:19759313-19759335 GAGAGCAGTGAGGCGGCTGGTGG - Intronic
903017191 1:20368855-20368877 GAGGGTGGATAGGAGGCTGGAGG + Intergenic
903017794 1:20372860-20372882 GATGGCTGGGAGGCGGCGGGGGG + Intergenic
903115609 1:21176505-21176527 GGGGGCTGGGGGGAGCCTGGGGG + Intronic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
903653832 1:24936808-24936830 GATGGCTCGGAGGAGACTGGGGG + Intronic
904007979 1:27373758-27373780 GAGGGCTGGGAGGAGTGGGGAGG - Intronic
904043674 1:27598306-27598328 GGGGGCTGGAAGGGGGCTGGAGG + Intronic
904581898 1:31549711-31549733 GGGGACTGGGAGGAGGCTGTGGG - Intergenic
904770303 1:32877491-32877513 GAGGTCTCAGAGAAGGCTGGAGG + Intergenic
904939117 1:34152472-34152494 AAGGGCATTGAGGAGGCTGGAGG - Intronic
905865342 1:41373474-41373496 GAAGGGGGCGATGAGGCTGGAGG + Intronic
906079549 1:43075729-43075751 GAGGAGTGGGAGGAGGGTGGGGG - Intergenic
906195188 1:43925870-43925892 GAGGGCTGAGAGGTGGCCGTCGG + Intronic
906262914 1:44406954-44406976 TAGGGCAGCCAGGAGGCAGGGGG + Intronic
906264570 1:44418255-44418277 GAGGGATGGGAGGAGGTTGGGGG + Intronic
906552715 1:46679149-46679171 GATGGCTGAGTGGAGACTGGAGG + Intronic
907046902 1:51305054-51305076 CAGGGGTGCTAGGAGGCAGGTGG + Intronic
907288172 1:53395614-53395636 GGGGGTTGGGGGGAGGCTGGGGG - Intergenic
907792593 1:57681985-57682007 AAGGGCTGTGAGGAGGTAGGTGG - Intronic
911288733 1:96028961-96028983 GAGGGGGTCGAGGAGGCAGGGGG + Intergenic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
911851505 1:102826909-102826931 CAAGGCTGCAGGGAGGCTGGGGG + Intergenic
912203484 1:107484292-107484314 AAGGGCTACCACGAGGCTGGGGG + Intergenic
912682177 1:111736321-111736343 GAGCGCTGGGAGAAGGCTGAGGG - Intronic
912977935 1:114346647-114346669 GATGGCTGCGAGGCCGCTAGGGG - Intergenic
914334795 1:146704530-146704552 GAGGGCTGAGTGCAGGGTGGAGG + Intergenic
914847989 1:151293311-151293333 GCAGGCTGGGAGGAGGCTGGAGG + Intronic
914916468 1:151822303-151822325 GAGGGCTGGGTGGGGGCTGGGGG + Intronic
915333467 1:155127728-155127750 TGGGGAGGCGAGGAGGCTGGGGG - Exonic
915570135 1:156740879-156740901 GATGTCTGGGATGAGGCTGGTGG - Intronic
915765027 1:158354090-158354112 GAGGGCTGAGAGGAAGCTCTGGG + Intronic
915783605 1:158582146-158582168 GGGGGCAGCGAGGGGGTTGGAGG + Intergenic
917096448 1:171403594-171403616 GCTGGCTGCGTGGAAGCTGGAGG + Intergenic
917202546 1:172532968-172532990 GTGGCCTGCGCAGAGGCTGGTGG + Intronic
917234626 1:172877776-172877798 GAGGGATGGGGGGAGGGTGGAGG - Intergenic
917808924 1:178638633-178638655 AAGGGCTGAGTGGAGGCTTGAGG - Intergenic
918964331 1:191321928-191321950 GTGGGCTGCGGGGAGGGGGGAGG + Intergenic
919730856 1:200912856-200912878 GAGGCCAGGGAGCAGGCTGGAGG + Intronic
919861141 1:201740140-201740162 GGGGGCTGCGGCGGGGCTGGGGG - Intronic
920249773 1:204615827-204615849 GAGAGCTGGGAAGGGGCTGGAGG - Intergenic
920455380 1:206097235-206097257 GAGGGCTGCAGGGAGGCAGGAGG - Intronic
920672918 1:208018247-208018269 GAGGGGAGCAAAGAGGCTGGAGG - Intergenic
920688495 1:208128043-208128065 GAGAGCTGCGGGGAGCCTGAGGG + Intronic
921186214 1:212671791-212671813 CAGGGCAGGGATGAGGCTGGAGG - Intergenic
922155615 1:223038121-223038143 GAGGCCTGGGAGGAGGGAGGAGG - Intergenic
922243875 1:223776359-223776381 GAGGGCAAAGGGGAGGCTGGTGG + Intergenic
922482843 1:225951045-225951067 GTGGGCTGCGTAGATGCTGGTGG - Intergenic
922723277 1:227909778-227909800 GAGGGGAGGGAGGAGGCAGGAGG + Intergenic
923040144 1:230314086-230314108 GAGGAGTGCGAGGAGAATGGTGG + Intergenic
923108083 1:230869125-230869147 CAGGGCAGCCCGGAGGCTGGAGG + Intronic
923291176 1:232547571-232547593 GGGGGCTGGGTGGGGGCTGGGGG + Intronic
923799055 1:237189048-237189070 AAGGGCTGGGAGGAGGACGGGGG - Intronic
924112183 1:240711205-240711227 GAGGGGTCAGAGGATGCTGGAGG - Intergenic
1062799432 10:368466-368488 CAGAGCTGCGGGGATGCTGGAGG + Intronic
1062834203 10:625223-625245 GAGGGCTGCGCAGAGGCTTGCGG - Intronic
1062857555 10:786831-786853 GAGGCCTGAGAGCCGGCTGGGGG - Intergenic
1062939026 10:1407891-1407913 GAGAGAAGTGAGGAGGCTGGAGG + Intronic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1063017951 10:2096787-2096809 GAGGGGTTGGAGGAGGCTGGAGG - Intergenic
1063581978 10:7316376-7316398 AGGGGCTGGGTGGAGGCTGGTGG + Intronic
1064230962 10:13528991-13529013 GCGGGCTGCGGGGAGGGCGGCGG + Intergenic
1064354362 10:14604179-14604201 GAGGGGCGCGGGGAGGCGGGCGG - Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1065021978 10:21508931-21508953 GAGGGCTGCGGAGAGGCGGAGGG - Intergenic
1065789208 10:29244255-29244277 TGGGGCTGCCTGGAGGCTGGAGG + Intergenic
1065926136 10:30434751-30434773 GAGTGCAGCTCGGAGGCTGGAGG + Intronic
1066162302 10:32746765-32746787 AAGTGGTGCGAGGAGGCTGCAGG - Intronic
1066749219 10:38635706-38635728 GCGGGCTGGGACGAGGGTGGCGG - Intergenic
1066967439 10:42282086-42282108 GCGGGCTGGGACGAGGGTGGCGG + Intergenic
1067092682 10:43277285-43277307 GAAGGCTGGGAGAAGGCTGGAGG - Intergenic
1067095329 10:43295692-43295714 GAGGGGTGAGAGGAGGCGGAGGG - Intergenic
1067704729 10:48598343-48598365 AAGGGCTGGGTGGAGGGTGGTGG + Intronic
1068743425 10:60501203-60501225 GTGGGCTGAGAGCAGGCAGGAGG + Intronic
1068936403 10:62639597-62639619 GGGGGCTGTGAGTAGGTTGGGGG - Intronic
1070668575 10:78362468-78362490 GAGGGCTGGGAATAGGATGGGGG - Intergenic
1070806691 10:79274948-79274970 GAGGGCTGCGAGGGGTGGGGCGG + Intronic
1070811177 10:79298813-79298835 GAAGGATGCAAGGAGGCGGGTGG + Intronic
1070823368 10:79375995-79376017 GAGGGCTAAGAGAAGGCTGGTGG + Intergenic
1071302359 10:84265516-84265538 GAGAGCTGCCAGGTGGATGGAGG - Intergenic
1071491311 10:86138572-86138594 AAGAGCTGTGGGGAGGCTGGTGG - Intronic
1072430661 10:95368080-95368102 GAGGGCTGTGGAGAAGCTGGTGG - Intronic
1072913781 10:99524612-99524634 GGAGGCTGAGAGGAGGCTGCTGG + Intergenic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073073496 10:100809241-100809263 GGGGGCTTCCAGGAGGGTGGGGG + Intronic
1075417437 10:122275261-122275283 GAGGGCAGAGAGCAGGCTTGTGG + Intronic
1075445431 10:122509671-122509693 GATGGCTGCGGGGAGTCTGCTGG + Intronic
1075504359 10:123009014-123009036 GAGGCCTGCGGCGAGGATGGAGG + Exonic
1075651939 10:124132893-124132915 GAGGGGTGATAGGAGCCTGGGGG + Intergenic
1075762030 10:124864385-124864407 GAGGTCTGCGAGGAGCCCGTGGG + Intergenic
1075934626 10:126328932-126328954 GATGTCTGCCAGGTGGCTGGAGG + Intronic
1075936110 10:126342899-126342921 GAGGGCTGGAGGGAGGGTGGAGG + Intronic
1076103021 10:127797798-127797820 GAGGGATGAGGGGAGGCTGCGGG - Intergenic
1076362485 10:129899070-129899092 CAAGGCTGCGCGGAGGCAGGAGG - Intronic
1076474732 10:130744085-130744107 ATGGGCTGGGTGGAGGCTGGGGG + Intergenic
1076512756 10:131024057-131024079 GAGGGCTGCAGGGAGCATGGTGG + Intergenic
1076921121 10:133455326-133455348 GAGGGTGATGAGGAGGCTGGGGG + Intergenic
1076998922 11:312527-312549 GAGGGGTGGGTGGAGGGTGGGGG + Intronic
1077010487 11:377107-377129 GAGGACAGCGAGGAGGCCGCGGG + Exonic
1077145466 11:1042382-1042404 GGGGGCTTTGAGGAGGGTGGGGG + Intergenic
1077168314 11:1153542-1153564 GAGGGTTCCCAGGAGGCAGGTGG + Intergenic
1077172312 11:1172587-1172609 GAGGGCTGGGAGGGCACTGGTGG + Intronic
1077356602 11:2121710-2121732 GAGGACTCCGAGGAGGCCTGGGG + Intergenic
1077375983 11:2205340-2205362 GAGGGAGGTGGGGAGGCTGGAGG - Intergenic
1077405398 11:2380242-2380264 GTGGGCTCTGGGGAGGCTGGTGG + Intronic
1077451860 11:2653240-2653262 GAGGGCAGGGAGAAGGCTTGTGG - Intronic
1077890188 11:6412922-6412944 AAGGGCTGTGAGGAGGCAGAGGG - Intronic
1078526411 11:12104886-12104908 GGGGACAGCGAGGAGGCTGAGGG - Intronic
1078669013 11:13348504-13348526 GAGGGCTGTGTGGGGGCTGTGGG + Intronic
1079133417 11:17762644-17762666 GAGGGATGAGAGGGGCCTGGAGG + Intronic
1079195437 11:18322562-18322584 GCTGGCTGCGAGGAGTCTGAGGG - Intronic
1080383972 11:31799725-31799747 CGGGACTGCGAGGAGGCTGCCGG - Intronic
1080864392 11:36180488-36180510 GAGGCCTGCGAGGAGAGTGGCGG + Intronic
1081597766 11:44471032-44471054 GAGGGCAGAGGGGAGGCAGGCGG - Intergenic
1081872134 11:46388017-46388039 GAGAGCTAAGAGGAGCCTGGTGG - Intergenic
1082428901 11:52637178-52637200 GAGGGCTGTGAGGACTGTGGTGG + Intergenic
1082464514 11:53152275-53152297 GAGGGCTTTGAGGCGGGTGGTGG + Intergenic
1083184477 11:61009180-61009202 GAGGCCTCTGAGGAGGCTGTTGG + Intronic
1083571378 11:63763785-63763807 GAGGACGGCCAGGAGCCTGGGGG - Exonic
1083639252 11:64136520-64136542 GGGGCCTGCCTGGAGGCTGGGGG + Intronic
1083653704 11:64219223-64219245 GCGGGGGGAGAGGAGGCTGGAGG - Intronic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1083722789 11:64611712-64611734 CAGGCCTGGGAGGAGTCTGGGGG - Intronic
1084151668 11:67290392-67290414 GAGGGCCACGCAGAGGCTGGCGG + Exonic
1084529267 11:69717478-69717500 GAGGGAGGAGAGGAGGATGGAGG - Intergenic
1084739790 11:71132172-71132194 GAGGGAAGGGTGGAGGCTGGCGG + Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085197393 11:74680865-74680887 GAGAGCTGAGAGGGCGCTGGAGG - Intergenic
1085252118 11:75150843-75150865 GAGTGCAGTGAGGAGACTGGGGG + Intronic
1085345779 11:75767507-75767529 GAGGGCAGTGGGGAGGCTGTAGG - Intronic
1085408047 11:76275788-76275810 AAGGGGAGCGTGGAGGCTGGAGG - Intergenic
1086067606 11:82762986-82763008 GTGGGGTGCGGGGAGGGTGGAGG + Intergenic
1087216932 11:95504649-95504671 GAGGGGTGTGAGGAGGATGCAGG + Intergenic
1088783181 11:113155863-113155885 GAGGGCTGAGAGGAGGAGAGTGG - Intronic
1089432500 11:118436101-118436123 GAGGACTACGCGGAGGATGGAGG - Intergenic
1089479082 11:118790978-118791000 GAGGGCTGGGTGGGGGCGGGCGG - Intronic
1089604722 11:119635255-119635277 GAAGGCTGCAGGGAGCCTGGGGG - Intronic
1089685196 11:120142177-120142199 GAAGCCTGGGAGGAGGCTTGGGG - Intronic
1090073003 11:123560536-123560558 GGGGGCCCTGAGGAGGCTGGAGG - Intronic
1090710734 11:129382635-129382657 GAGGGCTGCAAGGACTCAGGTGG + Intronic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1091000960 11:131910632-131910654 GAAGGCGGCGCGGAGGCCGGGGG + Intronic
1091108452 11:132943870-132943892 GAAGGCGGCGCGGAGGCCGGGGG - Intronic
1091454684 12:598339-598361 GAGGGCAAGGAGGAGGGTGGGGG - Intronic
1091455927 12:607813-607835 TGGGGATGAGAGGAGGCTGGGGG + Intronic
1091556051 12:1574350-1574372 CTGGGGTGAGAGGAGGCTGGTGG + Intronic
1091706209 12:2695168-2695190 GAGGACTGGGAGGAGAATGGAGG + Intronic
1091778752 12:3200819-3200841 GCGGGCTGCGGGGGGGCCGGCGG - Intronic
1091807758 12:3367882-3367904 GAGGTCTACGGGGAGGCGGGGGG - Intergenic
1095349309 12:41189531-41189553 CAGGGCCGCGGGGATGCTGGTGG - Intronic
1095983476 12:47985496-47985518 GAGGGCTGCTAGGAGGGTGGGGG - Intronic
1096229583 12:49889619-49889641 GGGGCCTGCTAGGAGGGTGGGGG - Intronic
1096555190 12:52399598-52399620 GAGGCGTGGGAGGAGGCTAGTGG - Intronic
1096559542 12:52425640-52425662 CAGAGCTAGGAGGAGGCTGGAGG + Intronic
1096606137 12:52767902-52767924 GAGGCCTGCTCAGAGGCTGGAGG + Intergenic
1096656944 12:53097880-53097902 GAGGGCTGCGCGGAAGCTGAGGG + Exonic
1096723362 12:53541015-53541037 GAGGGCTGCGCGAGGCCTGGTGG - Intronic
1097153190 12:56994567-56994589 GGGAGCTGTGAGGAGGCTGGGGG - Exonic
1097225802 12:57476229-57476251 GTGGGCTGTGAGGAGGTGGGAGG + Intronic
1097608720 12:61789530-61789552 GGGGCCTGTCAGGAGGCTGGGGG + Intronic
1098123968 12:67270236-67270258 GCGGGCAGAGAGGAGGCTGCCGG - Intronic
1098688100 12:73451198-73451220 GTGGAATGAGAGGAGGCTGGAGG + Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100647139 12:96543453-96543475 AAGGGCTGCTAGGAGACTGGGGG + Intronic
1100927473 12:99565929-99565951 GAGGGCCTCTAGGAGGCTGAAGG - Intronic
1101997041 12:109533030-109533052 GAGGGCGAGGCGGAGGCTGGTGG - Intronic
1102147592 12:110666614-110666636 GAGTGTGGCGAGGAGGCTGTGGG - Intronic
1102457976 12:113082545-113082567 GAGGGCTGGGAGGTGGTTTGGGG - Intronic
1102458178 12:113084022-113084044 CAGGGCTGAGATGAGGTTGGAGG - Intronic
1103377623 12:120469299-120469321 GGGGTCTGCGCGGAGGCGGGGGG + Intronic
1103739288 12:123080617-123080639 GATGGGTTGGAGGAGGCTGGAGG - Intronic
1103954668 12:124569276-124569298 GAGGGCTGCCAGGCGGCCTGGGG - Intergenic
1104153993 12:126112925-126112947 CAGGGATGCGAGTAGGCAGGTGG - Intergenic
1104934642 12:132357971-132357993 GAGGAGTGGGAGGAGGCTGCCGG + Intergenic
1104950825 12:132439156-132439178 GAAGGCAGCCATGAGGCTGGAGG + Intergenic
1105074276 12:133261992-133262014 GAGGGCTGTGAGGAGCAGGGTGG - Intergenic
1105726194 13:23164773-23164795 CAGGGCTGGCAGGAGGCCGGAGG - Intergenic
1106013874 13:25850065-25850087 GAGGGCTGAGATGAGACAGGAGG - Intronic
1107070056 13:36259169-36259191 GAGGGCCGAGAGCAGGATGGCGG + Intronic
1110112001 13:71759374-71759396 GAGGGCAGCGTGGGGGTTGGGGG - Intronic
1110293989 13:73840856-73840878 AGGAGCTGCTAGGAGGCTGGTGG - Intronic
1111412153 13:87891286-87891308 GAGGGCTGTGATGATGATGGAGG - Intergenic
1112390498 13:98979400-98979422 GAGGGCTCAGAGGAGGCAGTGGG + Intronic
1112611986 13:100964346-100964368 GTGGGGTGCGGGGAGGCGGGAGG - Intergenic
1113364118 13:109660664-109660686 GAAGGCTGGGAGGAGGATGAGGG + Intergenic
1113365153 13:109669027-109669049 GAGGGGTGAGAGGAGCCTGAGGG + Intergenic
1113399198 13:109975760-109975782 GGGGGCTGCTAGGTGGCAGGGGG + Intergenic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1113431453 13:110255153-110255175 GAGTGCTGCAAGGACACTGGTGG + Intronic
1113925248 13:113938365-113938387 CAGGGCTGGCAGGAGCCTGGTGG + Intergenic
1113955856 13:114099648-114099670 GGGGGCTGTGGGGGGGCTGGGGG - Intronic
1114270831 14:21098761-21098783 CAGTGCTGCTTGGAGGCTGGGGG - Intronic
1114617169 14:24074473-24074495 GAGAGCTGCAAGGAGGGTGGGGG - Intronic
1115673474 14:35643181-35643203 GAGGGGTGGGGGGAGGCGGGAGG + Intronic
1115796138 14:36937677-36937699 TAGGGCTGCGAGGAGACGGATGG + Intronic
1116406588 14:44574004-44574026 GAAGGCTGGGAGGAGGGTGATGG + Intergenic
1116426578 14:44798881-44798903 GCGGGGGGCGAGGAGGCGGGGGG - Intergenic
1116515171 14:45796177-45796199 CAAGGCAGCAAGGAGGCTGGGGG + Intergenic
1116664331 14:47755614-47755636 GAGGGCTGCGATGAAGTTGGAGG + Intergenic
1116901625 14:50367240-50367262 GAGGGCTGAGAGATGCCTGGTGG + Intronic
1117135402 14:52730350-52730372 GAGGGCTGACAGGAGGGCGGCGG - Exonic
1118490557 14:66255371-66255393 GAGAGCTCTTAGGAGGCTGGGGG - Intergenic
1118992320 14:70808663-70808685 GAGGGCTGGGATGAGGGCGGGGG - Intronic
1119145578 14:72310752-72310774 GAAGGCTCAGGGGAGGCTGGTGG - Intronic
1119543351 14:75454992-75455014 GAGGGCTTGGACCAGGCTGGAGG + Intronic
1119703194 14:76768826-76768848 GAGGGCCGGGTGGAGGCTTGGGG + Intronic
1119859392 14:77925380-77925402 GAGGGCTTGGAGGAGCCTGCAGG + Intronic
1120569676 14:86101613-86101635 GAAGGCTGCAGCGAGGCTGGGGG - Intergenic
1120585965 14:86312639-86312661 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1121013173 14:90533738-90533760 GAGGGAGACGAGGAGGGTGGTGG + Exonic
1121310410 14:92932617-92932639 GACGGCTGAGAAGCGGCTGGAGG + Exonic
1121320111 14:92987248-92987270 AAGGGCTGCGAGTAGGCCTGTGG + Intronic
1121720761 14:96107103-96107125 GGGGGCTGCGAGGCACCTGGGGG + Intergenic
1121985473 14:98501351-98501373 GAGGGCTACAAGGAGCCGGGAGG - Intergenic
1122207952 14:100157529-100157551 GAGGGCTGGGAGGAACCTTGGGG - Intronic
1122262038 14:100529250-100529272 CAGGACTGCCAGGAGGCTTGGGG - Intronic
1122267431 14:100553259-100553281 CAGGGCTGAGAGGCGGCGGGAGG - Intronic
1122299649 14:100724557-100724579 GAGGGCTGTGGTGGGGCTGGGGG + Intergenic
1122299799 14:100725190-100725212 GCTGGCTCCAAGGAGGCTGGAGG - Intergenic
1122579270 14:102761484-102761506 GCCTGCTGCGAGGAGGCCGGGGG + Intergenic
1122771227 14:104098771-104098793 GATGGCAGGGAGGAAGCTGGAGG + Intronic
1122880302 14:104687854-104687876 GAGGAATGTGAGGAGGTTGGTGG - Intergenic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1123011384 14:105351097-105351119 GAGAGGTGCCAGGTGGCTGGAGG - Intronic
1124400461 15:29343486-29343508 TAGGGCAGCAGGGAGGCTGGAGG - Intronic
1124498811 15:30208747-30208769 GAGGCCTGAGAGGAGGCAGTTGG - Intergenic
1124500826 15:30225349-30225371 GAGGGCTGCGAGGCGGACAGTGG - Intergenic
1124621937 15:31278870-31278892 GAGGGCTGTGAGGAAGGTGTGGG + Intergenic
1124742745 15:32313318-32313340 GAGGGCTGCGAGGCGGACAGTGG + Intergenic
1124744768 15:32329929-32329951 GAGGCCTGAGAGGAGGCAGTTGG + Intergenic
1124830321 15:33142494-33142516 GAGAGCAGCGATGAGGCTTGTGG + Intronic
1124943504 15:34240825-34240847 GAGGCCTGTGAAGAGGTTGGTGG + Exonic
1125506412 15:40270262-40270284 GAGGGCTGTGAGGGGGGTGGAGG - Intronic
1125677845 15:41512048-41512070 GAGGGCTGCCTGGGGGCCGGGGG - Intronic
1125685080 15:41559185-41559207 GAGGGCGGGGAGGAGGCGGCGGG - Exonic
1125794452 15:42394167-42394189 GAGGGCTGGGACGGGGCTGGGGG - Intronic
1126798845 15:52282284-52282306 GAGGAGTGGGAGGAGACTGGAGG - Intronic
1127236617 15:57059735-57059757 GGGGGCTGGGGGGAGGGTGGAGG + Intronic
1127355363 15:58193777-58193799 CAAGGCTGCAGGGAGGCTGGGGG + Intronic
1128119244 15:65133570-65133592 GAGGCCTCCGCGGAGGCTCGGGG + Exonic
1128762011 15:70223504-70223526 GAGGCCTGAGGGGAGGCAGGAGG - Intergenic
1129001957 15:72342662-72342684 GATGGCTGCGCGGAGGTGGGCGG - Exonic
1129156212 15:73719739-73719761 GAGAGCTGCAAGGAGGAGGGTGG - Intergenic
1129281686 15:74490054-74490076 GGTGGCTGGGAGGAGGGTGGGGG - Intergenic
1129704222 15:77785360-77785382 AAGGCCTGGGAAGAGGCTGGTGG - Intronic
1129718937 15:77867138-77867160 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1129787080 15:78316605-78316627 GACAGCTGAGAGGAGGCAGGCGG + Intergenic
1129995895 15:80005977-80005999 GAGTGCTCCGAGGCTGCTGGAGG - Intergenic
1129999532 15:80034817-80034839 GAGAGCTGTGAGGAGGGTGTAGG + Intergenic
1130459997 15:84153722-84153744 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic
1130663448 15:85849973-85849995 GAGAGCTGGGAGGAGGCTAGCGG - Intergenic
1130844827 15:87734818-87734840 GAGGGGAGCGGGGAGGCGGGTGG - Intergenic
1130996975 15:88909302-88909324 GAGCTCTGCGATGAGGCTGCAGG + Intronic
1130997771 15:88913248-88913270 CAGGGCGACGAGGAGGCTGGGGG + Exonic
1131123697 15:89840034-89840056 GGGGGCTGCCATGAGGCAGGGGG + Intronic
1131144569 15:90002443-90002465 GAGGGCGACGAGGAGGAAGGGGG - Intronic
1131551657 15:93362415-93362437 GAGGGCTAGGAGGAGGGAGGGGG + Intergenic
1131668023 15:94590812-94590834 GGGGGCTGCCAGGATGCAGGTGG - Intergenic
1131694101 15:94856507-94856529 GAAGGCTGCGCGCAGGCTGCGGG + Intergenic
1132078592 15:98845386-98845408 GAGGGAGGCGAGGAGGAGGGAGG - Intronic
1132323131 15:100941950-100941972 GAGAGCTCCGAGGCTGCTGGGGG - Intronic
1132527670 16:425749-425771 GAGGGCGGCGAGGATCCGGGCGG - Exonic
1132537169 16:488022-488044 GAGGAGTGTGAAGAGGCTGGAGG + Intronic
1132684362 16:1156145-1156167 GCTGGCGGCGAGGAGGGTGGGGG - Intronic
1132685640 16:1160934-1160956 CAGGGCTGCACCGAGGCTGGGGG - Intronic
1132889396 16:2196534-2196556 GCGGGCGGCGAGGAGGCGGCGGG - Intergenic
1132892534 16:2211292-2211314 GGGGGCTGGGAAGTGGCTGGGGG - Exonic
1133038518 16:3047333-3047355 CAGGGCTGCCAGGATGGTGGTGG + Intronic
1134259197 16:12637266-12637288 GTGGGCTGCCTGGAAGCTGGAGG - Intergenic
1134649579 16:15898140-15898162 GAGGGCTGGGAGGAGGAAGGAGG - Intergenic
1135419958 16:22299089-22299111 AGGGCCTGGGAGGAGGCTGGGGG + Intronic
1136236119 16:28914595-28914617 GGGGGCAGGGAAGAGGCTGGGGG + Intronic
1136403292 16:30029971-30029993 GAGTGCAGAGTGGAGGCTGGTGG - Intronic
1136428249 16:30183336-30183358 AAGGCTGGCGAGGAGGCTGGGGG + Intronic
1136580802 16:31149801-31149823 GACGGAGGCTAGGAGGCTGGGGG - Intronic
1136733503 16:32441427-32441449 GAGGGCTGGGACGAGGGTGGCGG + Intergenic
1136778738 16:32884766-32884788 GAGGGCTGCGAGGGGAGGGGAGG + Intergenic
1136891880 16:33976748-33976770 GAGGGCTGCGAGGGGAGGGGAGG - Intergenic
1137493136 16:48949815-48949837 GAGGGCAGGGGAGAGGCTGGGGG - Intergenic
1138417385 16:56879262-56879284 GGGGGCTGGGTGGAGGCTGCAGG + Intronic
1139390932 16:66605772-66605794 GAGAGCGGCCAGGAGGGTGGGGG + Intronic
1139429729 16:66904709-66904731 GCCGGGGGCGAGGAGGCTGGGGG - Intergenic
1139603549 16:68001576-68001598 GAGGGTGGGGAGGAGGCAGGAGG + Intronic
1139972644 16:70785865-70785887 GAGTCCTGCAAGGAGGCAGGAGG + Exonic
1139998829 16:71006706-71006728 GAGGGCTGAGTGCAGGGTGGAGG - Intronic
1141128388 16:81417400-81417422 CAGGGCTGGGTGGAGGATGGTGG + Intergenic
1141173216 16:81704175-81704197 GGGGGCAGGGAGGAGGCTGAGGG - Intronic
1141425227 16:83940492-83940514 GGTGGCTTCGAGGAGGCAGGTGG + Intronic
1141617404 16:85217799-85217821 GAGGGCTTCGAGGAGGAGGCAGG - Intergenic
1141959149 16:87392706-87392728 GAGGCCTGGGAGGAGGCAGCCGG + Intronic
1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG + Intronic
1142105317 16:88299386-88299408 GAGGGCTTCGGAGAGGCCGGAGG + Intergenic
1142141460 16:88474529-88474551 CAGGGATGGGAGGAGGCGGGTGG - Intronic
1142227739 16:88885715-88885737 GAGGACAGGGAGGAGGCTGGTGG - Intronic
1142233261 16:88909715-88909737 CGGGGCTGTGAGGAGGCGGGAGG - Intronic
1142303680 16:89274011-89274033 GTGGGCTCCGAGGAGGAGGGAGG + Intronic
1203019580 16_KI270728v1_random:388175-388197 GAGGGCTGGGACGAGGGTGGCGG - Intergenic
1203037915 16_KI270728v1_random:661333-661355 GAGGGCTGGGACGAGGGTGGCGG - Intergenic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1142532206 17:587978-588000 CAGGGGTGGGAGGAGGCTTGGGG - Intronic
1142764490 17:2057693-2057715 GAGCGCTGCGAAGAGCGTGGTGG + Exonic
1143108484 17:4541060-4541082 CAGGGCTGGGAGGCAGCTGGAGG - Intronic
1143299678 17:5900187-5900209 AAGGGTTGGGTGGAGGCTGGAGG + Intronic
1143328512 17:6117458-6117480 GGGAGGTGAGAGGAGGCTGGGGG + Intronic
1143562932 17:7705801-7705823 GTGGGCAGGGAGGAGGCGGGAGG + Intronic
1143631177 17:8141174-8141196 GAGGGCTGCGAGGAGGCCCAAGG - Exonic
1144185850 17:12794341-12794363 GAGGGCTGTCATGAGGTTGGAGG + Intronic
1144451477 17:15383455-15383477 GAGAGCTGCGGGCAGGCTGCTGG - Intergenic
1144459997 17:15450937-15450959 GATGTCTTAGAGGAGGCTGGTGG - Intronic
1144952167 17:19000216-19000238 TAGGGCTGGAGGGAGGCTGGAGG + Intronic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145101568 17:20081618-20081640 GAGGGCTGAGGAGAGGATGGAGG + Intronic
1145280791 17:21465467-21465489 GAGGGCTGAGAGGAGGGGTGTGG + Intergenic
1145397120 17:22505097-22505119 GAGGGCTGAGAGGAGGGGTGTGG - Intergenic
1145442181 17:23122107-23122129 GAGGGCTGTGAGGATTGTGGTGG + Intergenic
1145446926 17:23187552-23187574 GAGGGCTGTGAGGATTGTGGTGG + Intergenic
1145746769 17:27325642-27325664 CAGGCCTAGGAGGAGGCTGGAGG - Intergenic
1145780482 17:27559835-27559857 GGAGTCTGTGAGGAGGCTGGCGG + Intronic
1146380302 17:32322886-32322908 CAGGCCTGGGAGGAGGCAGGGGG + Exonic
1146601089 17:34216981-34217003 GAGGCCTGCCAGGAGGTGGGGGG - Intergenic
1146750355 17:35373384-35373406 GAGGGGTGCGGAGGGGCTGGGGG - Intronic
1147163305 17:38579978-38580000 GAGGGCTGCTTTGGGGCTGGTGG - Intronic
1147286124 17:39403496-39403518 CAGCACTGGGAGGAGGCTGGAGG - Intergenic
1147537256 17:41328769-41328791 TGGGGCTGCGGGGAAGCTGGTGG - Intergenic
1147671868 17:42181045-42181067 GAGGGAGGGGAGGAGGCAGGAGG - Exonic
1147746744 17:42699350-42699372 CAGGGCAGGGGGGAGGCTGGGGG - Exonic
1147883984 17:43672181-43672203 CAGGGCTGGGAGTAGCCTGGGGG + Intergenic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148163510 17:45465766-45465788 TAGAGCTGCAAGGAGGCCGGTGG + Intronic
1148350270 17:46936420-46936442 GAAGGCTGTGAGGTGGCTGGGGG + Intronic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1148750008 17:49940273-49940295 AAGGTCTGAGAGGAGGTTGGTGG + Intergenic
1148794260 17:50189608-50189630 GGGGGCTGCCAGAAGGATGGTGG - Intronic
1149457079 17:56796891-56796913 GAAGGCTTCGAGGAGGAAGGTGG - Intronic
1149996421 17:61408297-61408319 GAGGGCTCCAAGGCCGCTGGTGG + Exonic
1150016936 17:61566695-61566717 GTGGGGTGGGAGGAGGCGGGAGG + Intergenic
1150394737 17:64812418-64812440 CAGAGCTGCAAGGAGGCCGGTGG + Intergenic
1151327381 17:73387720-73387742 GAGAGCTGGGGGCAGGCTGGAGG + Intronic
1151458752 17:74242223-74242245 AAGGGCTTGGAGGAGGCTGGAGG + Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151627971 17:75289317-75289339 GAGGGCGGCGAGAAGGACGGAGG + Intronic
1151876423 17:76870005-76870027 CTGGGCAGCGAGGAAGCTGGGGG + Intronic
1151911261 17:77084862-77084884 CAGGGCTGAGAGGAAGCAGGTGG - Intergenic
1152058768 17:78052728-78052750 GAAGTCTACGAGGAGGCTGGAGG - Intronic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1152581287 17:81166483-81166505 GAGGGGGGCACGGAGGCTGGCGG + Intergenic
1152681394 17:81670189-81670211 GAGGCCTCAGAGGAGGCAGGAGG - Intronic
1152749378 17:82055622-82055644 GAGGCCAGCGAGCCGGCTGGTGG + Intronic
1153564272 18:6404097-6404119 GAAGGGTGGGAGGAGGGTGGGGG + Intronic
1154331272 18:13430814-13430836 GACGTCAGCGAGGGGGCTGGGGG - Intronic
1155096224 18:22559219-22559241 GAGGGCTGGTGGGAGGATGGGGG + Intergenic
1155246257 18:23913016-23913038 GTGGGCAGGGAGGAAGCTGGAGG - Intronic
1155655119 18:28183677-28183699 GAGGGCTTTGAGGAGCCTGCTGG + Intergenic
1156311716 18:35928787-35928809 TAGGGCTGGGAGGAGGGTAGGGG + Intergenic
1156456136 18:37295513-37295535 GAGGGCTCAGAGCATGCTGGAGG + Intronic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157257718 18:46153340-46153362 GCTGGCTGGGAGGAGGCTGAAGG + Intergenic
1157260925 18:46174664-46174686 GGGTGCTGAGGGGAGGCTGGAGG + Intronic
1157425921 18:47584167-47584189 GAGGGATACTAGGAAGCTGGCGG + Intergenic
1157919143 18:51697863-51697885 GAAGGCAACGAGGAGGCTTGGGG - Intergenic
1157977436 18:52342018-52342040 GCGGACTCCGGGGAGGCTGGGGG - Intronic
1158277086 18:55780370-55780392 GCGGGCTGCGCGGAGGCTGCGGG - Intergenic
1158434960 18:57428848-57428870 GAGGGCTGCGAGAAACCTGTTGG - Intergenic
1158731536 18:60029819-60029841 GTGGGGTGCGGGGAGGCAGGAGG - Intergenic
1158841376 18:61391953-61391975 AAGGCATGAGAGGAGGCTGGAGG - Intronic
1158877373 18:61745953-61745975 GTGGGGTGGGAGCAGGCTGGGGG + Intergenic
1160671831 19:368807-368829 GTGGGAAGAGAGGAGGCTGGAGG - Intronic
1160725481 19:616259-616281 GAGGGCTGCGAGGCGGACAGTGG - Exonic
1160875517 19:1294695-1294717 GGGTGCTGAGAGGAGGGTGGAGG + Intronic
1161018865 19:1998474-1998496 GGTGGCTGTGAGGACGCTGGGGG + Intronic
1161242593 19:3230706-3230728 GGAGGCTGGGAAGAGGCTGGTGG - Intronic
1161268959 19:3378939-3378961 GAGGGCTGCTGGAAGGGTGGGGG - Intronic
1161322346 19:3647064-3647086 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322368 19:3647136-3647158 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322377 19:3647170-3647192 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322393 19:3647220-3647242 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322404 19:3647258-3647280 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161346254 19:3770259-3770281 GAGGGCTGCGAGGCTGTGGGTGG - Exonic
1161454668 19:4363990-4364012 GAGGGCAGTGCCGAGGCTGGAGG + Intronic
1161455928 19:4369714-4369736 CAGGGGTGCGAGGAGTCAGGCGG - Intronic
1161487739 19:4544584-4544606 GAGGGCCCCGAGGAGGTAGGAGG - Intronic
1161487991 19:4546142-4546164 GAGGGGAGGGAGGAGGCTGGAGG - Intronic
1161611960 19:5248059-5248081 TAGGGCTGGGTGGAGGGTGGGGG + Intronic
1161668160 19:5589576-5589598 GCTGGCCGTGAGGAGGCTGGTGG - Intronic
1161821728 19:6534116-6534138 GAGGGCGGTGAGGGGGTTGGAGG - Intronic
1161849593 19:6731568-6731590 GAGGGAGGGGAGGGGGCTGGGGG + Intronic
1162362145 19:10226924-10226946 GAGGGATGGGAGGGGGTTGGGGG - Intronic
1162906227 19:13825716-13825738 GAGGGCTGCCAGGTGGATGCGGG + Intronic
1163009150 19:14413783-14413805 TGGGGCTGCCAGGATGCTGGTGG + Intronic
1163500679 19:17674422-17674444 GAGGCCAGGGCGGAGGCTGGCGG + Intronic
1163509432 19:17726315-17726337 GAGCGCTCCGAGGTGGCTGCTGG + Exonic
1163585382 19:18160987-18161009 TGGGGTTGGGAGGAGGCTGGGGG + Intronic
1164578645 19:29420837-29420859 GTGGGTGGAGAGGAGGCTGGGGG - Intergenic
1164598114 19:29543523-29543545 GAGGTCCGGGAGGAGGCTGTAGG - Intronic
1164767134 19:30780816-30780838 GTGGTCTACCAGGAGGCTGGAGG + Intergenic
1164767778 19:30784928-30784950 GAGGGTTGGGAGCAGGCCGGAGG - Intergenic
1164776728 19:30858682-30858704 GTGGGCTGCGTGGGGGCTTGGGG - Intergenic
1165149756 19:33753690-33753712 GAGGGTTGGTAGGAGGATGGTGG - Intronic
1165160216 19:33811586-33811608 GAGGGCTCCGCGGACGCCGGGGG - Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165472922 19:36013910-36013932 GGGGGATCCGAGGAGGCTGAGGG - Intronic
1165856368 19:38881068-38881090 TGGGGATGCGGGGAGGCTGGGGG + Intronic
1165899668 19:39163206-39163228 GAAGGCTGAGTGCAGGCTGGAGG + Intronic
1166107287 19:40603722-40603744 GAGGGGAGGGAGGAGGCAGGCGG - Intronic
1166500488 19:43337562-43337584 GAAGTCTGTGAGGAGGCTGTGGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166706208 19:44909292-44909314 GCAGGCTGCGCGGAGGCAGGAGG - Exonic
1166742506 19:45122881-45122903 GGGGTCAGCAAGGAGGCTGGAGG - Intronic
1166794984 19:45420537-45420559 AAGAGGTGCGAGGAGGCAGGAGG - Intronic
1166831404 19:45641876-45641898 GAGGTCTTGGAAGAGGCTGGGGG + Exonic
1166856833 19:45786405-45786427 GAGGGCCGCGTGGTGGCTCGAGG - Exonic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1166944521 19:46388670-46388692 GAGGGCTACGAGGTGGCTCACGG + Exonic
1167270587 19:48503562-48503584 GGAGGCTGGGAGGAGGCTGTGGG - Intronic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167609914 19:50502040-50502062 GAGGGCTCTGCAGAGGCTGGCGG - Intergenic
1167620562 19:50557691-50557713 GAGGGCTGGGTGGGGGGTGGTGG + Intronic
1167638404 19:50667819-50667841 GGGGCCTGGGAGGCGGCTGGGGG + Exonic
1167639024 19:50670166-50670188 GTGGGCTGGGAGGAGTCTGTTGG - Intronic
1167991611 19:53365651-53365673 GGGGCCTGCGAGGAGGTGGGCGG - Intergenic
1168102353 19:54148040-54148062 GAGGCCAGAGAGGAGGCTGCTGG + Intronic
1168155332 19:54471213-54471235 GAGGGGTGGGCGGAGGCGGGGGG - Intronic
1168185830 19:54698700-54698722 GAGGGCTGGGAGGAGACGGGGGG + Intronic
925024252 2:595235-595257 GATGCTTGCCAGGAGGCTGGGGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925891568 2:8438953-8438975 GAGGGCTCCTAGGAGCCTGAAGG + Intergenic
926312569 2:11685291-11685313 GAGAGCGGTGTGGAGGCTGGCGG + Intronic
926715161 2:15918607-15918629 GAGGTCTGGGAGGAGGCTTGTGG + Intergenic
926751267 2:16200402-16200424 GAAGGCTGCGGGGATGGTGGCGG - Intergenic
927110579 2:19861330-19861352 GAGTTCTGGGAGGAGGTTGGGGG - Intergenic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927807645 2:26162068-26162090 GGTGGCTGCCAGGAGTCTGGAGG - Intergenic
927939737 2:27096001-27096023 GCAGGCTGCAAGGGGGCTGGGGG + Intronic
928032979 2:27797264-27797286 GAGGGCTGAGAGTGGGCTGTGGG + Intronic
928228750 2:29477715-29477737 GAGGGATGCGAGGGAACTGGAGG + Intronic
929658727 2:43760792-43760814 CAGGGCTGGGAGGAGGAGGGAGG - Intronic
930136360 2:47906541-47906563 GAGGGCCGCGGGGCGGCGGGGGG + Intergenic
931206937 2:60156779-60156801 GAAGGCTTGGTGGAGGCTGGAGG - Intergenic
931665629 2:64608206-64608228 AGGGGCTGCGAGGTGGGTGGAGG - Intergenic
932340594 2:70960734-70960756 GTGGGCTGCTAGTGGGCTGGGGG - Intronic
932374550 2:71224076-71224098 GAGGGCTGAGACAAGGCTGAGGG - Intronic
932444670 2:71770917-71770939 GTGGGGTGGGAGGAGGGTGGTGG - Intergenic
932520221 2:72404139-72404161 CAAGGCAGCGGGGAGGCTGGGGG + Intronic
932625578 2:73293373-73293395 GCGGGTGGCGGGGAGGCTGGCGG + Exonic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934713411 2:96529782-96529804 GAGGGCTGCGTGGAGGCTGAAGG - Intergenic
934723940 2:96602828-96602850 GAGGCCTTGGAGGAGGCTGCTGG + Exonic
935021724 2:99238631-99238653 GAGGTCTGCGAAATGGCTGGGGG - Intronic
935266152 2:101396014-101396036 GAGGGCCAGGAGGAGTCTGGAGG - Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935622811 2:105144065-105144087 GGGGGCCGGGAGGAGGATGGGGG - Intergenic
936011580 2:108928466-108928488 GATGGCAGTGATGAGGCTGGTGG - Intronic
936228558 2:110679932-110679954 GAGGGCTCCATGGAGGCTGGGGG + Intergenic
936524802 2:113235304-113235326 GAGGCCAGAGAGGGGGCTGGCGG + Intronic
936866663 2:117082300-117082322 TAGGGGTGAGAGGAGGATGGTGG - Intergenic
937221521 2:120345344-120345366 GGAGGCTGCGAGGAGGCGGGCGG + Intergenic
937287291 2:120761575-120761597 GAGGGCTAGGAGGAGTGTGGAGG + Intronic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
938125449 2:128667649-128667671 GACGGCTGGGGTGAGGCTGGTGG + Intergenic
938366196 2:130736564-130736586 GAGGGCTGGGGGGAGGCTGTAGG - Intergenic
938406980 2:131038260-131038282 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407013 2:131038382-131038404 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407034 2:131038473-131038495 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938963188 2:136361359-136361381 GAGGGCTGAGAGAAGCCTGAGGG + Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940884632 2:158978259-158978281 TAAGGCTGCCAGAAGGCTGGAGG - Intronic
940954419 2:159712391-159712413 GAGAGCTGCGGGCGGGCTGGAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941130936 2:161650452-161650474 GGGGGCTGGGAGCAGGCAGGAGG + Intronic
941915990 2:170814274-170814296 GAGGGCTGGGGCGAGTCTGGTGG + Intronic
942114416 2:172713521-172713543 GAGGGGGCCGAGGAGGCAGGGGG + Intergenic
942318407 2:174714972-174714994 GAGGGCTGAGAGGAGGCAGGAGG + Intergenic
942491429 2:176493458-176493480 GTGGAGTGGGAGGAGGCTGGTGG + Intergenic
946144469 2:217718565-217718587 TAAGGCTTTGAGGAGGCTGGAGG + Intronic
946247571 2:218396343-218396365 GAGGGACCCGACGAGGCTGGAGG - Exonic
946372786 2:219290706-219290728 GAGGGCTGGGCAGAGCCTGGAGG + Intronic
946822895 2:223648354-223648376 GAGAGCTGCGAGGTGTCAGGTGG + Intergenic
947498987 2:230658761-230658783 GAGGCCTGGCAGGAAGCTGGTGG - Intergenic
947545593 2:231008214-231008236 AAAGGCTGCGAGGAGGGAGGTGG + Intronic
947717972 2:232351366-232351388 GAGGCCCACGAGGAGGCCGGCGG - Intergenic
947729336 2:232419484-232419506 GTTGGCTGCCAGGAGGCCGGCGG + Intergenic
947741424 2:232486711-232486733 GAGGCCCACGAGGAGGCCGGCGG - Exonic
947871343 2:233440573-233440595 GAAGGCTGCAGGGAGGCGGGAGG + Intronic
948080669 2:235202820-235202842 CAGGGCTTCCAGAAGGCTGGTGG - Intergenic
948216749 2:236237952-236237974 GAGGCCTGCGGGGAGGGAGGTGG + Exonic
948673752 2:239585021-239585043 GAGGGCTCCGAGCAGGTTGGGGG - Exonic
949034499 2:241810351-241810373 GGGGGCGGCGAGGAAGCAGGAGG - Intronic
1168842426 20:917937-917959 GAAGGCTCAGGGGAGGCTGGAGG - Intergenic
1169195513 20:3680376-3680398 CAGGGCTGCGTGGAGGGGGGAGG - Intronic
1169216235 20:3796351-3796373 GAGGGATGCGGGGAGGGCGGGGG - Exonic
1169226080 20:3857838-3857860 GAGGCCAGGGAGCAGGCTGGGGG - Intronic
1170298149 20:14852125-14852147 GAGGGATGGGAGCAGGCGGGAGG + Intronic
1170568847 20:17621694-17621716 GAGGGCTCCGCGGGAGCTGGCGG + Exonic
1170724671 20:18915784-18915806 GAGGGCTCAGAGGAGCCTGCCGG + Intergenic
1170732761 20:18988764-18988786 GAGGGCTGAGAGGGGGGTGCAGG - Intergenic
1170957161 20:20991789-20991811 CAGGGCTGCAAGGAGTCTTGTGG - Intergenic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1171401323 20:24874523-24874545 GGGGGCTTCCAGGAGGCTGACGG - Intergenic
1171428531 20:25064012-25064034 GAGGGCTGCAAGGGGTCTTGTGG - Intergenic
1172098623 20:32472918-32472940 GAGAGATGCAGGGAGGCTGGGGG - Intronic
1172167517 20:32908026-32908048 GAGGCCTGGGGGCAGGCTGGGGG + Intronic
1172493984 20:35364928-35364950 GAGGGTTGCAAGAAGGCTAGGGG - Intronic
1172587354 20:36093837-36093859 GGGGGCTGGGGGGAGGCCGGAGG - Intronic
1172869237 20:38125582-38125604 GAGGGAGGTGGGGAGGCTGGGGG + Intronic
1173202052 20:40961468-40961490 GAGGGCTGAGAGGCTGCTGAGGG - Intergenic
1173249695 20:41358007-41358029 GAGGGCAGAGAAGAGGCTGCTGG - Exonic
1173857466 20:46259650-46259672 GAGGGCTGCCTGGAGGAGGGGGG + Intronic
1174053932 20:47785510-47785532 GGGGGCGGGGAGGAGGCAGGAGG - Intronic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175199213 20:57266456-57266478 GGAGGCAGCGAGGAGGCAGGCGG + Exonic
1175423887 20:58852501-58852523 CGGGGCTGCCTGGAGGCTGGGGG + Intronic
1175931775 20:62496960-62496982 GACGGCCTCGGGGAGGCTGGCGG + Intergenic
1175950602 20:62581313-62581335 GGGGGGTGCGCGCAGGCTGGGGG - Intergenic
1176025414 20:62982995-62983017 GGTGGCTGCGAAGAGGATGGGGG + Intergenic
1176081780 20:63277076-63277098 GGGGGCCGGGAGGAGGCTGCGGG + Intronic
1176084365 20:63289367-63289389 GAGGGCTGCTTGGACCCTGGTGG + Intronic
1176106552 20:63392251-63392273 GAGGGCTGAGCAGGGGCTGGGGG + Intergenic
1176193230 20:63824000-63824022 GAGTGCAGAGAGGAGGCTGTAGG + Intronic
1177824590 21:26068312-26068334 GAGGGCTGAGAAGAGACTGATGG - Intronic
1178279189 21:31266335-31266357 AAGGACTGCGAGGAGGCTCGGGG - Exonic
1178978228 21:37239039-37239061 GAAGGCTCCGAGGAAGCTGGTGG - Intronic
1179488521 21:41726204-41726226 GAGGGCCTCGACCAGGCTGGAGG - Intergenic
1179787990 21:43740616-43740638 AAGGGCTCCCAGGAGGCTGGTGG + Intronic
1179891637 21:44338687-44338709 GAGGGAGGGGAGGAGGCCGGGGG - Intronic
1179917153 21:44484983-44485005 GCGGGCGGGGAGGAGGGTGGGGG + Intergenic
1179940492 21:44636640-44636662 GAGGGTTGCGTGGAGAGTGGAGG - Intronic
1179980022 21:44890987-44891009 GAGATATGGGAGGAGGCTGGGGG + Intronic
1179981129 21:44896585-44896607 GAGGGCGCAGAGGAGGGTGGTGG - Intronic
1180163217 21:46007154-46007176 GGGGTCTGCGTGGTGGCTGGGGG - Intergenic
1180397551 22:12367665-12367687 GCGGGTTGCGAGGAGGCGAGAGG + Intergenic
1180402169 22:12496470-12496492 GCGGGTTGCGAGGAGGCGAGAGG - Intergenic
1180538970 22:16423658-16423680 GCGGGCTGGGATGAGGGTGGCGG - Intergenic
1181600989 22:23951832-23951854 GAGCCCAGGGAGGAGGCTGGAGG + Intergenic
1181607520 22:23989494-23989516 GAGCCCAGGGAGGAGGCTGGAGG - Intergenic
1182278645 22:29205890-29205912 GAGGGCGGGCAGGAGGCGGGCGG - Exonic
1182310694 22:29403516-29403538 GAGACCAGCTAGGAGGCTGGTGG + Intronic
1182690353 22:32157232-32157254 GAGACCAGCTAGGAGGCTGGTGG - Intronic
1183095385 22:35548883-35548905 GAGGACTGCAAGAAGGCTTGTGG + Intronic
1183195179 22:36348845-36348867 GAGGGCTCCGAGGTGGGGGGGGG - Intronic
1183383715 22:37503225-37503247 GAGGGCAGGGAGGGGGCAGGAGG + Intronic
1183512831 22:38245890-38245912 GAGGGCTGGCGGGGGGCTGGGGG - Intronic
1183625743 22:39000313-39000335 GAGGGGAGCGAGGGGGCCGGGGG + Intergenic
1183830385 22:40415764-40415786 GAGGCCTGGGAGCAGGGTGGGGG - Intronic
1183898953 22:40990865-40990887 GAGCGCTGCGGAGAGGCTGGAGG + Intergenic
1183943192 22:41308217-41308239 GAGGGCTGCAGGGAAGGTGGGGG + Intronic
1184201169 22:42970949-42970971 GAGGGCTGTGGAGAGGCTGGGGG - Intronic
1184220600 22:43097356-43097378 CAGGCCTGAGAGGAGTCTGGGGG - Intergenic
1184244173 22:43227516-43227538 AAGGGCAGAGGGGAGGCTGGCGG + Intronic
1184369385 22:44072955-44072977 GAGGTATGTGAGAAGGCTGGGGG - Intronic
1184685274 22:46094015-46094037 GGGGCCTGGGAGGAGGCTGCAGG - Intronic
1184723678 22:46330622-46330644 AATGGCAGCGAGGAGGGTGGCGG - Exonic
1184737242 22:46406511-46406533 GAGTGCTCCCAGCAGGCTGGTGG - Intronic
1185082148 22:48715448-48715470 CAGGGAGGCGAGGAGGCTGGGGG + Intronic
1185131398 22:49041115-49041137 GAGGGCTGCAAGGAGGCACTTGG + Intergenic
1185236258 22:49715107-49715129 GAGGGGTGTGGGGAGGCGGGTGG + Intergenic
1185266144 22:49905326-49905348 GAGGGCTCCGAGGAGCCTGGTGG - Intronic
1185276255 22:49951273-49951295 GACGGGGGCGGGGAGGCTGGGGG + Intergenic
1185370729 22:50459794-50459816 CAGGGCTGGGGGGTGGCTGGGGG - Intronic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
950556618 3:13699813-13699835 GAGGGCTGTGAGGATGATAGTGG + Intergenic
950805795 3:15601982-15602004 GAGGGCTGCGCAAAGGCTGCCGG + Intronic
951647738 3:24912165-24912187 GAGGGCTATGACGAGGCAGGGGG + Intergenic
952382519 3:32816550-32816572 GAGTGCTGGGAGGGGGCTGGGGG - Intergenic
953238514 3:41127169-41127191 GAGGGCTGAGATGGGGCAGGAGG - Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
953902851 3:46853000-46853022 GAGGGGTGGGAGGGGGCAGGGGG - Intergenic
953904376 3:46861149-46861171 GAGGGGGGCAAGGAGGCAGGAGG - Intronic
954144968 3:48630002-48630024 GAGGGCGGCGAGGAGCCATGGGG + Intronic
954194696 3:48989734-48989756 AATGCCTGCGAGGAGGCTGTGGG + Intergenic
954639346 3:52088850-52088872 GAGGGCTGGGAGATGGCGGGAGG - Intronic
955058141 3:55474264-55474286 GAGAGACCCGAGGAGGCTGGAGG + Intronic
956736608 3:72243395-72243417 GTGGGCTGGGAGGAGGAGGGAGG + Intergenic
956945553 3:74218485-74218507 AAGGGCTACTTGGAGGCTGGTGG - Intergenic
957084896 3:75669688-75669710 GAGGCCTCCGAGGAGTCTGAGGG - Intergenic
957215798 3:77317831-77317853 GGGGGCTGCTAGGGGGCTGCTGG + Intronic
957752448 3:84439091-84439113 GTGGGGTGGGAGGAGGCGGGAGG + Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961045505 3:123705142-123705164 GATGGCTGGGAGGAAGCCGGGGG - Intronic
961384641 3:126516654-126516676 GGGGGCTAGGAGGATGCTGGGGG - Intronic
961437077 3:126926635-126926657 GAGGGTAGAGATGAGGCTGGTGG + Intronic
961564487 3:127753970-127753992 GACAGCTGTGACGAGGCTGGTGG - Intronic
961818746 3:129564555-129564577 GAGGGCTGCCTGGAGGATTGTGG - Intronic
961826586 3:129602342-129602364 GAAGGCTGTGAGCAGGCTCGAGG - Intronic
962278009 3:134030178-134030200 GAGGGCTGTGCGGGGGCAGGAGG + Intronic
962629792 3:137264224-137264246 GGAGGCTGGGTGGAGGCTGGGGG - Intergenic
963870715 3:150410518-150410540 GAGGGCTGCGCGGGGCTTGGCGG - Exonic
964573992 3:158144276-158144298 GAGGGGTGGGAGGAGGGGGGAGG - Intronic
965081766 3:164041900-164041922 GGGGGTTGAGAGGAGGCTGAAGG - Intergenic
965400418 3:168206495-168206517 AAGGGCTGCCAGAAGGCTGTGGG - Intergenic
965832197 3:172804763-172804785 GAAGACTGCGAGGAATCTGGAGG - Intronic
965984695 3:174736860-174736882 GAAGGCTGAGAGGGGGCTGAGGG - Intronic
967266821 3:187698772-187698794 CAGTGCTACGAGGAGGATGGTGG - Exonic
967859304 3:194139691-194139713 GGGGGGTTAGAGGAGGCTGGCGG - Intergenic
968066377 3:195761849-195761871 GGGGGCTGCGGGGAGGCGGGGGG - Intronic
968189987 3:196660611-196660633 GAGATCTGCGAGGTCGCTGGAGG - Exonic
968377210 4:53586-53608 GAGGGCTGAGAGGCGGCAGCGGG - Intronic
968574038 4:1356725-1356747 GTGGGCTGCGTGGGGGCTGCCGG + Intronic
968652296 4:1765021-1765043 GGGGGCTGCTATGGGGCTGGGGG + Intergenic
968672602 4:1859800-1859822 GTGGGGTGAGAGGAGGCTGGAGG - Intergenic
968704665 4:2072344-2072366 GGGGTCTGGGAGGTGGCTGGGGG - Intronic
968829582 4:2926072-2926094 GAGTGCTGGGAGGCGGGTGGGGG - Exonic
968929956 4:3573567-3573589 GAGGGCTGTGAGGTGGCGGGAGG + Intergenic
968956527 4:3722374-3722396 GGGGGCTGGGTGGAGGGTGGGGG + Intergenic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969392849 4:6902370-6902392 TAGGGATGAGAGGAGGATGGGGG + Intergenic
969615974 4:8252757-8252779 GGTGGCTGTGGGGAGGCTGGAGG - Intergenic
969665977 4:8557883-8557905 GGGAGCTGGGAGCAGGCTGGAGG - Intergenic
969683881 4:8658175-8658197 TAGGGTTGCCAGGAGGCTTGAGG - Intergenic
971263412 4:25077016-25077038 GAGGGCTGGAAGGAGGTTGGGGG - Intergenic
971300787 4:25440943-25440965 GAGCTCTGCTAGGAAGCTGGTGG + Intergenic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
972114035 4:35605641-35605663 GTGGGGTGGGAGGAGGGTGGAGG - Intergenic
974113752 4:57555883-57555905 GTGGGCTGGGAGGAGGGGGGAGG - Intergenic
977744313 4:100527515-100527537 GTGGGGTGGGGGGAGGCTGGAGG - Intronic
978105943 4:104902046-104902068 GAGTCCAGGGAGGAGGCTGGTGG - Intergenic
978715612 4:111839264-111839286 GAGGGCAGGGACAAGGCTGGAGG - Intergenic
979649027 4:123107784-123107806 GAGGGGTTCAAGGTGGCTGGGGG + Intronic
981531955 4:145761926-145761948 GAGGGCTCCGAGGGGCCGGGCGG - Intronic
981729192 4:147879696-147879718 GGGGTCTGTGAGGGGGCTGGGGG - Intronic
984090904 4:175374337-175374359 GAGGGCTGCGAGGGGGGGGAAGG + Intergenic
984206480 4:176792807-176792829 GAGGGCGGCGGGGCGGCTGGCGG + Intergenic
984912366 4:184686260-184686282 CAGGGCTGGGAGAAGGCTGTGGG + Intronic
985151716 4:186954129-186954151 GAGGGCTGCTGAGTGGCTGGTGG - Intergenic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985713395 5:1442661-1442683 GAGGCCCGCGAAGAAGCTGGGGG - Intronic
985806122 5:2044708-2044730 GAGAGCTGGGAGGTGGCGGGAGG - Intergenic
985962638 5:3314358-3314380 GAGGGCTGCAAGGAGGATGAGGG - Intergenic
985985847 5:3515684-3515706 GAAGGCTGCAGGCAGGCTGGGGG - Intergenic
986445357 5:7816368-7816390 GAGAGCAGGGAGGAGGCTTGGGG - Intronic
986475050 5:8121124-8121146 GAGGGCTATCTGGAGGCTGGGGG + Intergenic
988792313 5:34620015-34620037 GAGGGCAGGGAAGAGGCTGCTGG + Intergenic
989497492 5:42125914-42125936 GAGGGTTGGGGGGAGGGTGGTGG + Intergenic
989780744 5:45262219-45262241 GAGGGCTGCGAGGCGGAGAGTGG + Exonic
990347553 5:54884493-54884515 GAGGGTTGGGAGGAGGCAGAAGG + Intergenic
991015838 5:61931445-61931467 GAGGGCTGCTAGGTGGCTGATGG - Intergenic
991291307 5:65035844-65035866 GAGGGTTGCGGGCAGCCTGGGGG + Intergenic
994281085 5:97902860-97902882 CAAGGCTGCAATGAGGCTGGGGG - Intergenic
995244707 5:109922537-109922559 GGGGGCTGGGGGGAGGCTGTGGG + Intergenic
996576265 5:124979373-124979395 GAGGGATGGGAGGAGGAAGGGGG + Intergenic
997367393 5:133334843-133334865 CAGGGCTGCCAGGAGGCCTGGGG + Intronic
997756351 5:136403155-136403177 GATGTCTGAGGGGAGGCTGGAGG + Intergenic
998353107 5:141513781-141513803 CAGTGCTTCGAGGAGGCAGGCGG - Intergenic
998643934 5:144041871-144041893 GGGGGCGGCGGGGAGGCTGTAGG + Intergenic
999156150 5:149458829-149458851 AAGAGGTGCGAGGAGGCTGTGGG - Intergenic
999775207 5:154806983-154807005 TAGGGCTGGGAGGATTCTGGGGG - Intronic
1000041166 5:157486285-157486307 AATGGCTGTGAGGAGGCAGGTGG + Intronic
1000612969 5:163395435-163395457 AAGGGGTGGGAGGAGGGTGGAGG + Intergenic
1000918141 5:167106765-167106787 GAGGGCAGTGAAGAGGGTGGGGG + Intergenic
1001195399 5:169668937-169668959 AGGGGCTGCGTTGAGGCTGGTGG + Intronic
1001395898 5:171419592-171419614 GCGGGCGGCGAGGGGGCGGGGGG - Intergenic
1001590461 5:172861090-172861112 GAGGTCAGCGAGGCGGATGGAGG - Intronic
1001684053 5:173579370-173579392 GAAGGCTGGAATGAGGCTGGAGG + Intergenic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001768307 5:174272701-174272723 GTGGGCTCAGAGCAGGCTGGGGG - Intergenic
1001997558 5:176174480-176174502 GAGGGCTCCATGGAGGCTGGGGG + Intergenic
1002059215 5:176616598-176616620 GTGGGCTTCTAGGAGCCTGGGGG + Intergenic
1002160407 5:177311363-177311385 GCGGGCGGTGAGGAGGCCGGGGG - Exonic
1002304745 5:178276553-178276575 GAGAGCTGGGAGGAGGCTCAGGG - Intronic
1002342736 5:178527455-178527477 GAAGGCTGCGGGGTGCCTGGAGG - Intronic
1003955874 6:11164725-11164747 GTGTGCTGCGAGGTGGCTGGGGG + Intergenic
1004549868 6:16636385-16636407 AAGGGCTGCCTGGGGGCTGGGGG - Intronic
1004705735 6:18122265-18122287 GAGGGCTCCGGGGGCGCTGGGGG + Exonic
1005809625 6:29506072-29506094 GAGGGCTCAGGGGAGGCTGAGGG - Intergenic
1005825131 6:29627856-29627878 GAGGGCTGCTAAGAGGGTGCCGG + Intronic
1006079941 6:31559256-31559278 GGGGGCCATGAGGAGGCTGGGGG + Intergenic
1006084815 6:31588037-31588059 GAGCGCTGAGAGGAGGGTTGGGG + Intronic
1006373094 6:33657404-33657426 GAGGGCTGCCTGGAGGCAGTGGG + Intronic
1006405688 6:33843556-33843578 GAGGCTTGGGAGGAGGCTGGGGG - Intergenic
1006439127 6:34042446-34042468 GATGGCTGGGAGGAGGAAGGGGG + Intronic
1006866651 6:37214050-37214072 GAGGGCTGGAGGGAGGCTAGTGG - Intronic
1006898252 6:37484296-37484318 GAGGGCGGCTGGCAGGCTGGTGG - Intronic
1006935208 6:37712445-37712467 AAGGGCTGTGATGAGGGTGGAGG - Intergenic
1007358754 6:41340964-41340986 AAGGGCTGGGAGGGGCCTGGAGG - Intronic
1007507326 6:42346119-42346141 GAAGGCTGCGAGGAAGAGGGTGG + Intronic
1007763806 6:44149700-44149722 GAGGGCTGGGGTGAGGGTGGGGG - Intronic
1008604855 6:53130438-53130460 GAGGGCGGGGAGGGGGCAGGCGG + Intronic
1009808701 6:68634985-68635007 GAGGGCGGGGGAGAGGCTGGCGG - Intergenic
1010422714 6:75692719-75692741 GTGGGATGCGGGGAGGATGGGGG - Intronic
1014429439 6:121349887-121349909 AAGGGCTTGGAGGAGGCAGGAGG - Intergenic
1015326849 6:131933046-131933068 GAGGGCTGCTAGGAGGTTATGGG + Intergenic
1017113020 6:150950273-150950295 TAGGGCTGGCAGGAGGATGGAGG - Intronic
1017511871 6:155121855-155121877 GAGGCCTGCGAGGAGGGCGGGGG - Intronic
1017637871 6:156460585-156460607 GAGGGCGGCGTGGAGGGGGGTGG - Intergenic
1017846468 6:158262669-158262691 GAAGGCTGGAAGAAGGCTGGAGG + Intronic
1017891419 6:158642941-158642963 AAAGGCTGCTAAGAGGCTGGTGG + Intronic
1018153546 6:160963388-160963410 CAGCGCTGCGATGAGGCTAGTGG + Intergenic
1018434959 6:163751426-163751448 TAGGGCTGCGGGGAGGGAGGAGG - Intergenic
1018711513 6:166500998-166501020 GAGAGCTGCGGGGCAGCTGGGGG + Intronic
1018715708 6:166530930-166530952 GCAGGCTGCGAGCAGGCTGTTGG - Intronic
1018733860 6:166673014-166673036 GAGGGCTGGGAGAGGGCTCGGGG - Intronic
1018787185 6:167117192-167117214 GAGGGATGCGGGGACGGTGGTGG - Intergenic
1018797235 6:167196078-167196100 GACTGCTGTGAGGAAGCTGGGGG - Intronic
1018819062 6:167358686-167358708 GACTGCTGTGAGGAAGCTGGGGG + Intronic
1018845359 6:167551860-167551882 GAGGACTGCGTGGAGGGTGGAGG + Intergenic
1018909804 6:168095489-168095511 GGGGGCTGCCAGGGGTCTGGCGG - Intergenic
1018910997 6:168101017-168101039 GAGGGCAGACAGGAGGCTAGGGG + Intergenic
1019299675 7:296791-296813 CAGGGCTGCGGGGTGGCGGGAGG + Intergenic
1019314040 7:376451-376473 GGGGGCTGAGGGGAGGCTGCCGG - Intergenic
1019338598 7:496706-496728 CAGGGCAGCCTGGAGGCTGGAGG - Intergenic
1020220499 7:6232937-6232959 GAGGGCTGCAGGGAGGTAGGAGG - Intronic
1020281640 7:6653115-6653137 GGGGGCTGCGCGGAGGCGGGTGG + Exonic
1021021167 7:15600104-15600126 GAGGGCTGAGAGGGTGCTGATGG - Intergenic
1021313360 7:19117861-19117883 GAGGGCGGCTAGGAGGCGGGTGG - Intergenic
1021498603 7:21304332-21304354 GAGGGGTGGGAGGAGGATGAGGG + Intergenic
1022335223 7:29415595-29415617 GAAGGCTGCGAGGAGGGAGATGG + Intronic
1022410615 7:30136041-30136063 GAGGGCAGCGCGGGGGCAGGGGG - Intronic
1023165019 7:37335286-37335308 GAGAGCTGGGAGAAGGCAGGGGG + Intronic
1023523368 7:41071681-41071703 GAGTGCTGCCAATAGGCTGGAGG - Intergenic
1023609260 7:41957283-41957305 GGGGGCTGGGAGGAAGCTGAGGG + Intergenic
1023858506 7:44201326-44201348 GAGGGATGAGGGGAGGGTGGAGG + Intronic
1024048197 7:45599586-45599608 GGGGGCTGTGAGGAGGTTTGTGG + Intronic
1024324220 7:48096071-48096093 GAGGCCTAGTAGGAGGCTGGTGG + Intronic
1024533380 7:50410841-50410863 GGAGGTTGGGAGGAGGCTGGGGG - Intergenic
1024741283 7:52357818-52357840 GATGGTGGAGAGGAGGCTGGAGG - Intergenic
1024889633 7:54185270-54185292 GAGGGCTGCGAGGGGACTCCGGG + Intergenic
1024909788 7:54433590-54433612 CAGGCCTGGGAGCAGGCTGGGGG + Intergenic
1025152823 7:56573772-56573794 GAGAGCTGCTAGGAACCTGGAGG + Intergenic
1026737401 7:72957717-72957739 CAGGGCTGTGGGGAGGCTGAGGG + Intergenic
1026841428 7:73671538-73671560 GAGGCCCGAGAGGGGGCTGGGGG + Exonic
1027106331 7:75407351-75407373 CAGGGCTGTGGGGAGGCTGAGGG - Intronic
1028477136 7:91264977-91264999 GAGGGCAGCGGGGACGCCGGTGG + Exonic
1028996265 7:97103819-97103841 GAGGGGTGGGAGGAGGGTGAGGG + Intergenic
1029362996 7:100100759-100100781 AAGTGGCGCGAGGAGGCTGGAGG - Intronic
1029607590 7:101608540-101608562 GATGGCTGTGAGGCTGCTGGCGG - Intergenic
1029622601 7:101699309-101699331 CAGGGCTGCGCTGAGGCAGGAGG - Intergenic
1029706335 7:102278218-102278240 GAGGGCAGCTAGCAGGCAGGTGG - Intronic
1030227549 7:107169415-107169437 GGGGGCCGGGAGGAGGCAGGGGG + Intronic
1030466106 7:109905842-109905864 CAGGGCGGCAGGGAGGCTGGGGG + Intergenic
1032003750 7:128283834-128283856 GAGGACTGAAAGAAGGCTGGTGG - Intergenic
1032089440 7:128903956-128903978 GAGGCATGTGAGGGGGCTGGAGG + Intronic
1032138115 7:129300280-129300302 AAGGGTAGTGAGGAGGCTGGGGG - Intronic
1032189602 7:129756631-129756653 GAGAGCTGGGAGGAGGGAGGAGG - Exonic
1034107350 7:148501759-148501781 CAGTTCTGTGAGGAGGCTGGAGG + Intergenic
1034204630 7:149304799-149304821 TCGGGCTGCGTGGAGGCTGCCGG + Intergenic
1034359443 7:150481163-150481185 GAGGAAGGAGAGGAGGCTGGGGG - Intergenic
1034443789 7:151101487-151101509 GGTGGCTGGGAAGAGGCTGGTGG + Intronic
1034708808 7:153172387-153172409 GGGGGCTGGGGTGAGGCTGGTGG + Intergenic
1034889796 7:154829785-154829807 GAGGGCTTTGAGCAGGATGGAGG - Intronic
1035356181 7:158277259-158277281 CAGGACCCCGAGGAGGCTGGAGG - Intronic
1035496601 7:159333237-159333259 GAGGGCTGTGAGGAGCAGGGTGG - Intergenic
1036181147 8:6586414-6586436 CAGGGAAGCGTGGAGGCTGGAGG - Intronic
1036293761 8:7518289-7518311 GAGGGGTGCGGGCAGGGTGGAGG - Intergenic
1036328800 8:7802706-7802728 GAGGGGTGCGGGCAGGGTGGAGG + Intergenic
1037692970 8:21198260-21198282 GAAGGCTTTGTGGAGGCTGGGGG - Intergenic
1037776103 8:21836702-21836724 GAGGGCTGCCGGCAGGGTGGGGG - Intergenic
1038614013 8:29076414-29076436 GAGGGCTGGGAGAAGGGAGGTGG - Intronic
1039435313 8:37556018-37556040 GGGGGCTGGGAGAAGGCTGTTGG - Intergenic
1039475588 8:37837826-37837848 GAGGGGCCCGGGGAGGCTGGGGG + Exonic
1039608516 8:38901488-38901510 GAGGGGCGCGCGGGGGCTGGCGG + Intronic
1039845262 8:41321438-41321460 GAGGGCAGCCTGGAGGCTAGGGG - Intergenic
1040371301 8:46778615-46778637 GTGGGGTGGGAGGAGGCGGGCGG - Intergenic
1042176532 8:66042710-66042732 GAGGGGTGCGAGGAGGGGGAGGG - Intronic
1044143675 8:88686119-88686141 CAGGGCGGCAACGAGGCTGGGGG + Intergenic
1044623742 8:94216436-94216458 GAGGCCTGGGAGGAGGCCGGCGG + Intronic
1045088073 8:98709011-98709033 GAGGGCTGCAAGGAGAGAGGGGG + Intronic
1045414472 8:101952492-101952514 GAGGGCTGAGATGTGTCTGGTGG - Intronic
1045525747 8:102940160-102940182 GAGGGCTACGTGGGGGTTGGGGG + Intronic
1047535270 8:125713515-125713537 CAGGGCTGGGGGGAAGCTGGAGG + Intergenic
1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG + Intergenic
1047752200 8:127890316-127890338 GAGAGGGGAGAGGAGGCTGGGGG - Intergenic
1048335699 8:133500533-133500555 GAGGGCAGTGATGAGGGTGGGGG + Intronic
1048783466 8:138025909-138025931 GAGTGCTGCAAGGAGCCTGTGGG - Intergenic
1048980920 8:139703157-139703179 GCGGGGGGCGGGGAGGCTGGGGG + Intergenic
1048985109 8:139730929-139730951 GAGGGCTGGGAGGGGTCTGGGGG + Exonic
1049101153 8:140580006-140580028 GTGGGCTGCGAGGAGGAGGTGGG - Intronic
1049257600 8:141622293-141622315 AAGGGCTGGGAGGAAGCTGGAGG - Intergenic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049492766 8:142913921-142913943 GAGGGTTGAGAGGCAGCTGGAGG - Intronic
1049708150 8:144052142-144052164 GCGGCGTGCGCGGAGGCTGGGGG - Intronic
1049735344 8:144202216-144202238 GTGGGCTGTCTGGAGGCTGGCGG + Intronic
1051459349 9:17294824-17294846 GAGGGCGGGGAGGAGGGGGGAGG + Intronic
1051459358 9:17294843-17294865 GAGGGCGGGGAGGAGGGAGGAGG + Intronic
1051739957 9:20241747-20241769 GAGGAGTGGGAGGAGGTTGGGGG + Intergenic
1053453672 9:38214268-38214290 GGGGCCTGAGATGAGGCTGGAGG + Intergenic
1055000769 9:71446909-71446931 GAGAGCCGCGCGCAGGCTGGAGG - Intergenic
1057304892 9:93906337-93906359 CAGGGCCGTGAGGAGGCGGGAGG + Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1057885458 9:98826550-98826572 GAAGGCCAGGAGGAGGCTGGGGG - Intronic
1057894282 9:98894668-98894690 GAGGGCTGCCTGGGGGTTGGGGG + Intergenic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1059243211 9:112826317-112826339 GAGGGTTGGCAGAAGGCTGGGGG + Intronic
1059314155 9:113410136-113410158 GGGAGCTGCGAGGAGACCGGGGG + Exonic
1059332520 9:113544671-113544693 CAAGGCTGCTGGGAGGCTGGGGG - Intronic
1059365968 9:113786637-113786659 GAGGGGGCCGATGAGGCTGGAGG + Intergenic
1059375384 9:113876590-113876612 GCGGGGTGCGAGGAGGGTGGGGG + Intronic
1060232831 9:121838350-121838372 GAGACCAGCGAGGAGGCTGTGGG - Intronic
1060512320 9:124243005-124243027 GAGGGCTGGGACGCAGCTGGCGG + Intergenic
1060765514 9:126292976-126292998 GAGTGCTGCCAGGAGGTTTGAGG - Intergenic
1060769518 9:126321778-126321800 AATGGCTGAGAGGAGGATGGAGG + Intergenic
1060876062 9:127084433-127084455 GAGGGCTGCCTGGATGGTGGGGG - Intronic
1060911282 9:127353045-127353067 GAGGGCTCCGAGGACACAGGGGG - Intronic
1061043644 9:128153140-128153162 GGCGGCTGCGAGGGGGCTTGTGG + Intronic
1061102205 9:128500586-128500608 GAGGGCTGTAAGGGGACTGGTGG - Exonic
1061133381 9:128720527-128720549 GCGGGCAGTGAGGAGGCTGTGGG - Exonic
1061178319 9:129010249-129010271 GAAGACTGCGGGGAAGCTGGTGG - Intronic
1061299809 9:129697944-129697966 GAGGGGAGCGTGGAGGTTGGAGG + Intronic
1061498614 9:130989914-130989936 CAGGGCTGCCTGGAGGATGGCGG + Intergenic
1061677149 9:132223916-132223938 GAGGTCTGCAATGAGGCTGGGGG - Intronic
1061780266 9:132991755-132991777 GAGTGATGCGGGGAGGCTTGAGG + Intergenic
1061878032 9:133554630-133554652 GAGGTGTGCGAGCAGGCCGGCGG + Exonic
1061985055 9:134125824-134125846 GAGGGATGAGCCGAGGCTGGAGG + Intergenic
1062056983 9:134473905-134473927 GAGTGTGGCGTGGAGGCTGGAGG + Intergenic
1062163748 9:135094979-135095001 CGGGGCTGCGGGGAGGCGGGAGG - Intronic
1062174143 9:135151645-135151667 GAGGGCGGCCTGGAGGCTGGGGG - Intergenic
1062192780 9:135256329-135256351 GGGGGCAGCGAGGAGCCGGGAGG - Intergenic
1062367515 9:136218322-136218344 GAGCGCTGCACGGGGGCTGGGGG - Intronic
1062392986 9:136341332-136341354 GAGGGCTGCTGGGAGGCGAGAGG + Intronic
1062397110 9:136356959-136356981 CAGGGCTGCCAGCTGGCTGGTGG + Intronic
1062475089 9:136722725-136722747 CAAGGCTGCCAGGAGGCGGGAGG + Intronic
1062518026 9:136945800-136945822 GGGGGCTGAGAGGAGGGTTGGGG - Intronic
1062636228 9:137492972-137492994 GAGGGCTCCCAGGAGGCTCTGGG + Intronic
1203770942 EBV:49817-49839 GAGGTCTGCGATGAGGCGGTGGG + Intergenic
1203572026 Un_KI270744v1:140660-140682 GAGGGCTGAGAGGCGGCAGCGGG + Intergenic
1187940468 X:24375982-24376004 GAGGGCTGTGCAGGGGCTGGGGG - Intergenic
1189293845 X:39904964-39904986 GAGGTCGGTGAGGAGGCTGTGGG - Intergenic
1189337005 X:40176322-40176344 GAGGGCTGCGAGGTGGCTCGCGG - Intronic
1192152252 X:68719517-68719539 GAGATATGCCAGGAGGCTGGAGG + Intronic
1193323394 X:80151442-80151464 GTGGGGTGCGGGGAGGCGGGAGG - Intergenic
1195289061 X:103414143-103414165 GCTGGCAGGGAGGAGGCTGGCGG + Intergenic
1195687655 X:107600982-107601004 CAGGGGTGAGAGAAGGCTGGAGG + Exonic
1197776257 X:130120596-130120618 GGGGCCTGCGAGGTGGCTCGAGG + Intergenic
1197817967 X:130517789-130517811 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1198434448 X:136602422-136602444 GTGGGGTGGGAGGAGGCGGGAGG + Intergenic
1198584521 X:138105685-138105707 AAGGGCTGCAGCGAGGCTGGGGG + Intergenic
1198592415 X:138198705-138198727 CAAGGCTGCAATGAGGCTGGGGG + Intergenic
1199086245 X:143633800-143633822 GCGGGCGGCGAGGAGGCTGGAGG + Intronic
1199790895 X:151154125-151154147 GAGTGCTGGGGGCAGGCTGGGGG + Intergenic
1200063071 X:153492159-153492181 CAGGGCTGGGAGGAGGCAGGGGG - Intronic
1200100584 X:153687772-153687794 GAGGGCAGGGAGGAGGTGGGCGG + Intronic
1200153016 X:153960435-153960457 GAGGTCAGCAAGGAGGATGGAGG + Intronic
1200787634 Y:7274028-7274050 GATGGCTGCGAGGAAGGCGGGGG - Intergenic
1202372182 Y:24205971-24205993 GAGGGACGGGAGCAGGCTGGGGG - Intergenic
1202379249 Y:24261451-24261473 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1202491533 Y:25408670-25408692 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic
1202498603 Y:25464145-25464167 GAGGGACGGGAGCAGGCTGGGGG + Intergenic