ID: 1001749883

View in Genome Browser
Species Human (GRCh38)
Location 5:174120784-174120806
Sequence GGGCTCAGGAAGCTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 456}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001749883_1001749887 -3 Left 1001749883 5:174120784-174120806 CCCAGGCTCAGCTTCCTGAGCCC 0: 1
1: 0
2: 7
3: 45
4: 456
Right 1001749887 5:174120804-174120826 CCCAAATGCATGCTGCAGAGAGG No data
1001749883_1001749890 10 Left 1001749883 5:174120784-174120806 CCCAGGCTCAGCTTCCTGAGCCC 0: 1
1: 0
2: 7
3: 45
4: 456
Right 1001749890 5:174120817-174120839 TGCAGAGAGGCCTGCTAAGGAGG 0: 1
1: 0
2: 1
3: 22
4: 211
1001749883_1001749889 7 Left 1001749883 5:174120784-174120806 CCCAGGCTCAGCTTCCTGAGCCC 0: 1
1: 0
2: 7
3: 45
4: 456
Right 1001749889 5:174120814-174120836 TGCTGCAGAGAGGCCTGCTAAGG 0: 1
1: 0
2: 3
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001749883 Original CRISPR GGGCTCAGGAAGCTGAGCCT GGG (reversed) Intronic
900087102 1:903991-904013 GAGCTCTGGAAGGTCAGCCTAGG + Intergenic
900238815 1:1605120-1605142 GCGCCCAGGAGGCTGAGCCTTGG + Intergenic
900802551 1:4746377-4746399 TGGCTCAGGTACCTGAGCATGGG - Intronic
901500268 1:9648621-9648643 AGGCTCAGTAATCTGAGCCTGGG + Intergenic
901857576 1:12054166-12054188 GGGCTCAGGAGGCTGGGGCCTGG + Intergenic
902311917 1:15587484-15587506 GGGCTGAGGCAGCTGACCATGGG - Intronic
902620750 1:17649437-17649459 GGGCTCACCAATCTGGGCCTGGG - Intronic
902926637 1:19700322-19700344 GCACTCAGAAAGCTCAGCCTAGG + Intronic
903021503 1:20398563-20398585 CTGTTCTGGAAGCTGAGCCTGGG + Intergenic
903276043 1:22222542-22222564 GGGCCCAGGAACCTGAGGGTGGG + Intergenic
903334369 1:22615082-22615104 GGGCACAGGAAGCAGAGTCATGG - Intergenic
903543540 1:24109986-24110008 AGGCTCAGGAAGCGGATCCATGG + Intronic
903991963 1:27278566-27278588 GGGCTCAGGGAGGTGAGCAGAGG - Intronic
904462076 1:30686207-30686229 GGGAGGAGGAAGCTGAGCCTAGG - Intergenic
904497494 1:30895434-30895456 GGCCTCTGGGAGCTGAGCCCTGG - Intronic
905013496 1:34762171-34762193 GGGCTCAGGAAGCTCGCCCAGGG + Exonic
905168289 1:36096382-36096404 GGGCCCAGGAGGCTAAGGCTGGG - Exonic
905297486 1:36963320-36963342 GGTCTCAGGAGGCTGAGCGGGGG - Intronic
905915045 1:41678753-41678775 GGGCTGGGCATGCTGAGCCTTGG - Intronic
906508256 1:46395651-46395673 GGACTCAGGAGGGTGTGCCTGGG + Intronic
906510880 1:46409967-46409989 GGTCTCAGGCAGCTGATCCTGGG - Intronic
906543854 1:46607945-46607967 GGGCCCAGCCAGCTGGGCCTGGG - Exonic
906697907 1:47837140-47837162 GGGCTCAGGAAGCCAGGGCTGGG + Intronic
907112820 1:51942044-51942066 GAGCTCAGGAAGCAGAGGCAAGG - Intronic
907284222 1:53369976-53369998 GGGAACAGGCACCTGAGCCTTGG - Intergenic
910890541 1:92014913-92014935 GAGCTCAGGAATTTGGGCCTGGG + Intergenic
912531965 1:110331040-110331062 GTGCTCAGGAGGCTGAGGCAGGG + Intergenic
912797258 1:112700761-112700783 GGGCTCAGGAAGCTGGGGCCAGG - Intergenic
913403645 1:118463403-118463425 CTACTCAGGAGGCTGAGCCTTGG + Intergenic
915044248 1:152998758-152998780 TGGCTCAGGGAGCTAGGCCTTGG - Intergenic
915306606 1:154983412-154983434 GGGCTCAGTAATCTGAAGCTTGG + Exonic
915554146 1:156652144-156652166 GGGCTCAGGAGGGTGAGCCCTGG - Intronic
916684792 1:167134645-167134667 GGGGTGGGGAAGCTGAGCCGGGG + Intergenic
917553925 1:176064762-176064784 GGGCCCAGGAGGCTGAGGCAGGG - Intronic
917979321 1:180259557-180259579 GGGCGCCAGCAGCTGAGCCTGGG + Intronic
918238439 1:182601602-182601624 GGCCTCAGGCAGGTCAGCCTGGG + Intronic
918386426 1:184012955-184012977 GCCCTCAAGAAGCTGAGCCTAGG + Intronic
919801378 1:201356627-201356649 GGGCTCGGGAGGCTGAGGCAGGG - Intergenic
919979260 1:202632187-202632209 GGTCTCAGGAAGCCAAGTCTGGG + Intronic
920194006 1:204213983-204214005 GGTCACGGGAAGCTGACCCTTGG + Exonic
920703399 1:208234587-208234609 GGGCTCAGGGATCAGATCCTTGG - Intronic
922413359 1:225397116-225397138 GGGCTCGGGAGGCTGAGGCAGGG - Intronic
923104363 1:230843190-230843212 TGGCTCAGCACCCTGAGCCTAGG + Intronic
923766415 1:236896139-236896161 GGGCACAGGACGCTGAGGCCGGG - Intronic
1065810625 10:29439482-29439504 CAACTCAGGAGGCTGAGCCTGGG + Intergenic
1067281958 10:44879893-44879915 GAGCTGAGGAAGCTTCGCCTGGG - Intergenic
1068132620 10:52913258-52913280 GAGCCCAGGAAGTTGAGGCTAGG + Intergenic
1069772880 10:70910694-70910716 TGGCGCAGGAGGCTGAGGCTGGG + Intergenic
1070307182 10:75246559-75246581 GGGGGCAGGAAGCAGAGACTGGG - Intergenic
1070404345 10:76081357-76081379 CTGCTCAGGAGGCTGAGCCTGGG + Intronic
1070758913 10:79011047-79011069 GGGCACAGGATGCAGAGCCAGGG + Intergenic
1071545851 10:86528780-86528802 TTACTCAGGAGGCTGAGCCTGGG - Intergenic
1072034760 10:91553533-91553555 GGGCTTAGAAATCTCAGCCTGGG - Intergenic
1072363198 10:94680897-94680919 GAGGTAAGGAAGCTGGGCCTTGG - Intergenic
1074414021 10:113251401-113251423 GAGATGAGGAAGCTGAGACTCGG - Intergenic
1074982402 10:118630323-118630345 GGGTTCAGGAAGCTGCTCCTAGG + Intergenic
1075679729 10:124323497-124323519 AGGCGCAGGCAGCTGAGCCCAGG - Intergenic
1075904193 10:126066325-126066347 GGGATCAAGAAGATGAACCTGGG + Intronic
1076383604 10:130041205-130041227 GGACTCAGGAACCAGAGCCTCGG - Intergenic
1076520123 10:131076178-131076200 GAGCTCAGGATGCAGAGCCGAGG + Intergenic
1076549903 10:131271555-131271577 GGGCTCTGGGACCTGAGGCTTGG + Intronic
1076628095 10:131834169-131834191 GGCCTCAGGGAGCAGGGCCTGGG - Intergenic
1077469421 11:2750063-2750085 GAGGCCAGGAAGCGGAGCCTGGG + Intronic
1077701271 11:4444298-4444320 TAGGTCAGGAAGCTGAGCCATGG + Intergenic
1078086109 11:8233768-8233790 TGGCTCTGGGACCTGAGCCTCGG + Intronic
1078628370 11:12979306-12979328 GACCTCAGGAAGGTGAGCCTGGG - Intergenic
1080600731 11:33818966-33818988 GGTGACAGGAAGCTGAGGCTTGG - Intergenic
1081539311 11:44018487-44018509 GGGAAGAGGAAGTTGAGCCTGGG - Intergenic
1083572748 11:63768924-63768946 GGGCGCAGGCTGCTGAGCCTCGG - Intergenic
1083888325 11:65583590-65583612 AGGCCCAGGAAGCGGAGGCTGGG + Exonic
1084030819 11:66479779-66479801 GTGCTAAGGAAACTGAGGCTCGG + Intergenic
1084238963 11:67805816-67805838 GGGCTCAGGAGGCGGGGCCAGGG + Intergenic
1085309516 11:75507879-75507901 GGGCTCAGGCAGCTGAGGCTGGG - Intronic
1085519221 11:77128405-77128427 GGACTCAGGAAGCTGGGTCACGG - Exonic
1089518373 11:119048037-119048059 GAGCTGAGGAAGCTGTGCCAAGG - Exonic
1090012157 11:123054829-123054851 GAGCTCAGGATACTGAGCCTCGG + Intergenic
1090803617 11:130189424-130189446 AGGCTCAGGAAGGTGACACTCGG + Intronic
1091747671 12:3003097-3003119 GGGCTCAGGGAGAGGAGGCTGGG - Intronic
1092008798 12:5091743-5091765 TGGCTTAGGAAGCTCAGCTTGGG + Intergenic
1095941751 12:47732012-47732034 AGGCTCAGGAGGCTGAGCCATGG - Intergenic
1095962998 12:47847077-47847099 GGGCACAGGAAACGGAGCCCAGG + Intronic
1096685225 12:53283960-53283982 GGACTCAGGTAGCTTGGCCTGGG + Intronic
1096777095 12:53970895-53970917 GGGGGAAGGAAGCAGAGCCTTGG + Intergenic
1098024673 12:66189281-66189303 GGGCTCGGGCAGCCGAGCCATGG + Exonic
1100685505 12:96982998-96983020 GGGCTCAGGAAGCCATGCCTGGG - Intergenic
1101736030 12:107464001-107464023 GGGCTGACCAGGCTGAGCCTTGG - Intronic
1102050359 12:109857498-109857520 GGGCTCAGGTGGCAGGGCCTGGG - Intronic
1102229186 12:111250577-111250599 GGCCTTCGGAGGCTGAGCCTTGG + Intronic
1103052925 12:117796631-117796653 CAGCTGAGGAAACTGAGCCTTGG - Intronic
1103339264 12:120212598-120212620 GGGCTCAGGGAGCTGCCCCTCGG + Intronic
1103643924 12:122375884-122375906 CTACTCAGGAGGCTGAGCCTGGG - Intronic
1103913359 12:124363767-124363789 GGGGTGAGGAGGCTGGGCCTTGG + Exonic
1104049580 12:125186548-125186570 GGGCGCGGGGCGCTGAGCCTCGG + Intergenic
1104735523 12:131133767-131133789 GGGCTGAGGAAGCACAGCCAGGG + Intronic
1105408671 13:20151704-20151726 GAGCTCAGCAAGCTGAGGCGGGG + Intronic
1107533150 13:41303647-41303669 GGGCTAAGAAAACTGAGGCTGGG + Intergenic
1109281860 13:60366039-60366061 GGGCTCAAGAACCTGAGAGTTGG + Intergenic
1112002675 13:95225919-95225941 GAGCTCAGGAAGATCATCCTGGG + Intronic
1113466762 13:110518606-110518628 CGGCTTGGGAATCTGAGCCTCGG - Intergenic
1113857531 13:113456198-113456220 GAGTTCTGGAAGCAGAGCCTGGG + Intronic
1115553641 14:34526759-34526781 GGACTCAGGAGGCTGAGGCAGGG + Intronic
1117102532 14:52364993-52365015 GGACTTAGGAGGCTGAGCCTAGG - Intergenic
1117186838 14:53248074-53248096 TGGGTGAGGAAGCTGAGGCTTGG + Intergenic
1118059214 14:62117076-62117098 GGGCCCGGGTAGGTGAGCCTCGG - Intergenic
1118279953 14:64419341-64419363 GGGCTCAGGAATCTGATGCAGGG - Intronic
1118729801 14:68658313-68658335 GGGCTCAGGACACTCAGCCCTGG + Intronic
1118780602 14:69005315-69005337 GGGCTAGGGAAGGTGAGGCTGGG - Intergenic
1119367747 14:74109371-74109393 CTACTCAGGAGGCTGAGCCTGGG + Intronic
1121107979 14:91293329-91293351 GGGGACAGGAAGGTGAGCTTTGG - Intronic
1121448427 14:93992891-93992913 GGGCCCAGGAAGCTGTGCTGGGG - Intergenic
1122130911 14:99604230-99604252 GGGCTCCGGGAGCTGGGCCGGGG - Intergenic
1122707237 14:103629096-103629118 GGGCTGGGGAAACTGAGGCTGGG - Intronic
1122891059 14:104732474-104732496 CAGCTCAGGACGCTGAGCCTGGG - Intronic
1123002898 14:105305832-105305854 GGGCACAGGAAGCTGGTGCTGGG - Exonic
1123012875 14:105357729-105357751 GGGCTCAGGCAGCTGTGCCATGG + Intronic
1124195604 15:27624089-27624111 AGGCTCAGCAAGCACAGCCTGGG + Intergenic
1124494857 15:30180143-30180165 GGTCTCAGGAAGCCAAGTCTGGG + Intergenic
1124748711 15:32358502-32358524 GGTCTCAGGAAGCCAAGTCTGGG - Intergenic
1126048107 15:44663326-44663348 GGGCTCAGTCAGCCGAGCCTAGG + Intronic
1127763527 15:62164277-62164299 GCGCTCAGGAAGCGGGGCCCTGG + Exonic
1128016410 15:64351814-64351836 GGCTGCAGTAAGCTGAGCCTGGG + Intronic
1128708372 15:69853681-69853703 TGGCTGAGTCAGCTGAGCCTTGG - Intergenic
1129184865 15:73899885-73899907 GGCCCCAGGGAGCTCAGCCTGGG + Intergenic
1129456395 15:75678067-75678089 GGGCTCTGGAGCCGGAGCCTGGG + Intronic
1129600686 15:76996512-76996534 GGGCTCAGCCGGCTGAGCCGAGG - Intronic
1129669733 15:77600726-77600748 GGGCTGGGAAAGGTGAGCCTGGG - Intergenic
1130094763 15:80847705-80847727 GGGCTCAGAAGGCTGATGCTGGG + Intronic
1130287975 15:82571362-82571384 GGGCTGAGGAATCTGAGTCCTGG + Exonic
1130930290 15:88421633-88421655 AGGCTGAGGATGCTGAGACTAGG + Intergenic
1131029723 15:89176357-89176379 GGGATCTGAAAGCTGGGCCTTGG + Intronic
1131221939 15:90591702-90591724 CTACTCAGGAGGCTGAGCCTGGG + Intronic
1132087917 15:98923104-98923126 GGGCTAAGGAAACTGAGGCAGGG - Intronic
1132659568 16:1055334-1055356 GGGCTCAGGGAGCCGAGGCCCGG + Intergenic
1132682030 16:1146362-1146384 GGGGGCAGGGAGCTGAGTCTGGG - Intergenic
1132764932 16:1529496-1529518 GAGATCAGGACGCTGCGCCTGGG - Intronic
1133422480 16:5658358-5658380 AGGCTCAGGAAGGACAGCCTGGG - Intergenic
1133451231 16:5905600-5905622 CTGTTCAGGAGGCTGAGCCTAGG + Intergenic
1133706575 16:8360329-8360351 GGGCAGAGGAAGGTGAACCTGGG - Intergenic
1135551143 16:23399171-23399193 GGGCTGCCGAGGCTGAGCCTGGG - Intronic
1135771166 16:25219658-25219680 GGCCTCAAGTAGCTTAGCCTGGG - Intronic
1135977994 16:27123832-27123854 GGGCTTGGTAAGCAGAGCCTGGG - Intergenic
1137401867 16:48160249-48160271 TGGCTCAGAGAGCTGATCCTAGG + Intergenic
1137524581 16:49223611-49223633 GGGCCAAGGAAGGTGGGCCTGGG - Intergenic
1138083758 16:54115589-54115611 GGGCCCAGGCAGGAGAGCCTTGG + Exonic
1138961570 16:62035522-62035544 GGGCTTTCGCAGCTGAGCCTTGG + Intronic
1139054774 16:63169331-63169353 AGGCTCAGGAATCTCAGCTTTGG + Intergenic
1139646978 16:68338563-68338585 GGGCGGAGGAAGCACAGCCTGGG + Intronic
1140473799 16:75228752-75228774 GGGCCCAGAAAGCACAGCCTGGG - Intronic
1140864353 16:79046964-79046986 GGGGTCAGGTAGCTCAGGCTGGG - Intronic
1140917353 16:79506283-79506305 ATGCTAAGGAAGCTGAGGCTCGG + Intergenic
1141450141 16:84093974-84093996 TGGCTCAGCCAGCTGACCCTGGG - Intronic
1141563106 16:84883407-84883429 TGGCCCAGGGAGCTGAGCCACGG + Intronic
1141878726 16:86844216-86844238 TGGCTCTGGAAGGAGAGCCTGGG - Intergenic
1142106816 16:88308871-88308893 GAGCTCAGGATGCAGAGGCTGGG - Intergenic
1142216083 16:88830671-88830693 TGGCCCAGGAAGCTGCCCCTCGG - Intronic
1142406297 16:89892119-89892141 GGGATCAGGCAGCCAAGCCTTGG + Intronic
1142646836 17:1319451-1319473 GAGCCCAGGAACTTGAGCCTGGG - Intergenic
1142820456 17:2462315-2462337 GGGCTCAGGAAGGAGAGAATAGG + Intronic
1142839088 17:2613306-2613328 GGGCCCTGGAAGCAGAGCCAAGG + Intronic
1142893067 17:2957661-2957683 ACTATCAGGAAGCTGAGCCTGGG - Intronic
1143111421 17:4555047-4555069 GGGCCCAGGGAGTTGAGACTGGG - Intronic
1143563743 17:7709404-7709426 GACCTCGGGAGGCTGAGCCTGGG + Exonic
1144656729 17:17042088-17042110 GGGCGCGGGAAGGCGAGCCTGGG + Intergenic
1144992732 17:19245004-19245026 AGGCTGAGCAAGCTGAGGCTCGG + Intronic
1145835203 17:27949519-27949541 AGGCTCAAGATGCTGACCCTTGG - Intergenic
1145857873 17:28179757-28179779 GAGCCCAGGAAGTTGAGACTAGG - Intronic
1145990335 17:29075505-29075527 AGGCTCAGGAAGGAGAGGCTGGG + Exonic
1146404300 17:32523901-32523923 TGGCTGAGGAAACTGAGGCTTGG - Intronic
1146454263 17:32996994-32997016 CTGCTCAGGTAGCTGGGCCTGGG + Exonic
1146685850 17:34841161-34841183 GGGCTTTGGAAGCTGGGCTTAGG - Intergenic
1146933851 17:36797677-36797699 GGGCTCAGGAAGCACACCCAAGG - Intergenic
1147253332 17:39166406-39166428 GGGATCAGGAAGCTGTGCCTGGG - Intronic
1147909555 17:43847353-43847375 GGGCTGAGGAGGCTGAGGATAGG - Intronic
1147978392 17:44260618-44260640 GGGCCCAGGAGGCTCACCCTTGG + Exonic
1148547062 17:48527096-48527118 GGGCTCAGGAAGCTCCGCGGCGG - Intergenic
1148906750 17:50917250-50917272 GGGCACAGGAAGCTGTGGCGGGG - Intergenic
1149596503 17:57867561-57867583 GACCTCAGGAAAATGAGCCTGGG - Intronic
1149648890 17:58263828-58263850 AGGCTCAGGAAACTAAGCTTTGG - Intronic
1150093677 17:62353262-62353284 AGGCTGAGGCAGCTGAGCCCAGG + Intergenic
1150267685 17:63841934-63841956 GGGCACGGGACGCTGAGGCTAGG - Intronic
1150686808 17:67327494-67327516 GGCCTCAGGGACCTCAGCCTAGG - Intergenic
1151096192 17:71501958-71501980 GGGGTCATGAAGAAGAGCCTGGG + Intergenic
1151340851 17:73469721-73469743 GGGATCAAGGAGCTGAGTCTGGG + Intronic
1151702888 17:75752732-75752754 GGGCACAGGAACCAGTGCCTGGG + Intronic
1151717820 17:75840407-75840429 GTCCTCACAAAGCTGAGCCTGGG - Intronic
1152195900 17:78918257-78918279 GGGCTCCGGAAGCTTTCCCTGGG + Intronic
1153666287 18:7370031-7370053 GGGCTCAGGATACTGAGGATGGG + Intergenic
1153918362 18:9766094-9766116 GGGCTCAGGAAGCTCAATCCAGG - Intronic
1154501465 18:14999829-14999851 GGGCTCAGCAGGCCGAGCCAGGG + Intergenic
1155025383 18:21935896-21935918 GGGCTTTGTGAGCTGAGCCTCGG - Intergenic
1155849258 18:30750410-30750432 CTACTCAGGAGGCTGAGCCTAGG + Intergenic
1156000581 18:32379775-32379797 GGGCTGAGGAAGCTGAGTTAGGG + Intronic
1156840301 18:41603083-41603105 GGGCTTAAAAAGATGAGCCTGGG + Intergenic
1160021938 18:75187932-75187954 GGCCTCAGGAAGCTTAGTCATGG - Intergenic
1160343688 18:78111686-78111708 GTGCGCAGGAGGATGAGCCTGGG + Intergenic
1160737535 19:670770-670792 GGGCTCAGGAAGGTGGGACCGGG + Intergenic
1161125758 19:2556347-2556369 CAGCTCAGGAAGCTGGGCCTGGG - Intronic
1161318885 19:3632026-3632048 GGGCCCAGGAAGCTGCCCCAGGG + Exonic
1161910925 19:7193252-7193274 AGGCTAAGGAGGCTAAGCCTGGG + Intronic
1162373051 19:10290291-10290313 GGAGTCAGGAAGCTGGGGCTCGG - Intronic
1162458889 19:10802744-10802766 GGGCTCCGGAAGCTGCTCTTTGG + Intronic
1162535905 19:11262613-11262635 GGGCTGGGGAAACTGAGGCTGGG + Intergenic
1162564253 19:11436361-11436383 GGGTACAGGAAGCTCAGCCCAGG - Intronic
1163047106 19:14651334-14651356 GGGCCCAGGAATTTGAGCCCAGG + Intronic
1163109845 19:15152965-15152987 GGGCTTAGGAAGCTGACCCAGGG - Intergenic
1163233108 19:16016934-16016956 GGGCAGAGGACGCTGACCCTGGG + Intergenic
1163659383 19:18567711-18567733 GGGCTCTGCAGGCTGAGCCTGGG + Intronic
1164658657 19:29942745-29942767 GGGCCCGGGCAGCTGGGCCTAGG - Intronic
1164684798 19:30159547-30159569 GTACTCATGGAGCTGAGCCTGGG + Intergenic
1164907776 19:31981640-31981662 GGGCTCAGGCAGTTGAACCTGGG + Intergenic
1164979785 19:32605273-32605295 AGGCTGAGGCACCTGAGCCTGGG + Intronic
1165973774 19:39656756-39656778 GGGACAGGGAAGCTGAGCCTGGG - Intronic
1166393295 19:42422271-42422293 GAGCTCAGAAAGCTGAGGCAGGG + Intronic
1166758716 19:45211666-45211688 CGGGTCAGGAAGCACAGCCTTGG + Intronic
1167010694 19:46805359-46805381 CTACTCGGGAAGCTGAGCCTGGG + Intergenic
1168528281 19:57106079-57106101 GGTCTCAGGAAGGTGGCCCTTGG - Intergenic
1168605117 19:57752497-57752519 GGGCCCATCATGCTGAGCCTGGG - Intronic
925279237 2:2671128-2671150 AGGCCCAGGAAGGTGAGCGTGGG + Intergenic
925853800 2:8110143-8110165 GGGCTCAGGAGGGTGAGGGTGGG + Intergenic
926163609 2:10504762-10504784 TGCCTCAGGACTCTGAGCCTTGG + Intergenic
928402563 2:30989887-30989909 GGGCTAAGGATACTGATCCTGGG - Intronic
929097669 2:38279373-38279395 GGCATGAAGAAGCTGAGCCTTGG + Intergenic
929444685 2:41992615-41992637 GGTCTCTGGAAGCTTAGCCTGGG - Intergenic
929928573 2:46234716-46234738 TAGCTAAGGAACCTGAGCCTTGG - Intergenic
929964623 2:46524960-46524982 GGACTCAGGAAGATCAGCCTGGG + Intronic
929997263 2:46836475-46836497 GGCCCCAGGAAGCGGAGTCTGGG + Intronic
931516184 2:63051825-63051847 GGGCGCTGGAAACTGGGCCTGGG - Intronic
931796642 2:65716905-65716927 GGGATCAAGAAGCTGATCTTTGG + Intergenic
932274601 2:70442701-70442723 GGGCCCAGGGAGCCTAGCCTTGG + Intergenic
933808951 2:86020336-86020358 GAGCTCAGGAGTTTGAGCCTGGG + Exonic
934588880 2:95528866-95528888 TGGCCCAGGGAACTGAGCCTTGG + Intergenic
937348568 2:121143885-121143907 GGGCCCAGGCCGCTGAACCTCGG + Intergenic
937940351 2:127280432-127280454 GTGCTGAGGTAGCTGGGCCTGGG - Exonic
938767241 2:134468527-134468549 GGACTCAGGAAGCATAGGCTGGG + Intronic
939875091 2:147568610-147568632 GGCCTCAGAAACCTGAGCATTGG - Intergenic
939963330 2:148585676-148585698 GGTTTGAGGAAGCTGGGCCTTGG + Intergenic
942168411 2:173265224-173265246 TAGCTGAGGAAGCTGAGGCTGGG + Intronic
942462305 2:176176854-176176876 GGGCACAGGGAGCTGAGACTGGG + Intergenic
942509415 2:176680915-176680937 CTGCTAAAGAAGCTGAGCCTTGG + Intergenic
942570541 2:177309884-177309906 CTACTCAGGAAGCTGAACCTGGG - Intronic
942866848 2:180686589-180686611 GGGCTGGGGAAGGTGAGGCTTGG + Intergenic
945305459 2:208255121-208255143 GGGCTGAGGAGGCGGGGCCTGGG - Intronic
946335466 2:219032516-219032538 GGGCTCAGGAAGATGGGCTGAGG + Exonic
946391455 2:219419080-219419102 GGGCACAGGAGGCTAGGCCTGGG + Intronic
946709412 2:222491243-222491265 CTGCTCAGGAAGCTGAGGCAGGG - Intronic
947736793 2:232459342-232459364 GCGCCCTGGGAGCTGAGCCTGGG + Exonic
947857111 2:233331498-233331520 GGGCTGAGAAAGCCTAGCCTTGG + Intronic
948797484 2:240412349-240412371 GAGCTCAGGAATCCGAGCCCAGG + Intergenic
948824269 2:240566789-240566811 GGGCTCAGGGAGCAGAGGTTGGG - Intronic
948852508 2:240715362-240715384 GGGCTCGGGAAGCCACGCCTGGG - Exonic
948928232 2:241113796-241113818 GGGGTCGGGGAGCTGGGCCTGGG - Intronic
949035512 2:241814203-241814225 CGGCTCTGGGAGCTGACCCTCGG - Intronic
1168840941 20:909849-909871 GGGCTCCAGAAGCTCAGTCTGGG - Intronic
1168980853 20:2002538-2002560 GGGATCTGGAAGCTGGGACTGGG + Intergenic
1169330211 20:4710350-4710372 GGCCTCAGGAAGGTGAGCCTTGG - Intergenic
1169379750 20:5096214-5096236 GGCTTCAGGGAGCAGAGCCTGGG - Intronic
1169550553 20:6697456-6697478 GTGCCCAGGAGGCTGACCCTTGG + Intergenic
1169564469 20:6838568-6838590 GGGTTCAGTAAGCAGAGCCCGGG + Intergenic
1170150477 20:13221635-13221657 GGGCCCGGGAAGCGGAGCCCTGG + Intergenic
1170653085 20:18260718-18260740 AGGGTGAGGAAACTGAGCCTCGG - Intergenic
1171367923 20:24639035-24639057 GGGCCCAGGAAGCAGAGCTGAGG + Intronic
1172131441 20:32658790-32658812 GGCCGGAGGACGCTGAGCCTTGG - Intergenic
1172152224 20:32798510-32798532 GGGCTCCTGAAGCTTGGCCTCGG - Exonic
1172525713 20:35599787-35599809 GGGCTCAGGCCGCTGAGCATGGG + Intergenic
1172530983 20:35631224-35631246 GAGCTCAGGAATCAGAGCCTTGG + Intronic
1172597255 20:36157861-36157883 GTGGGCAGGGAGCTGAGCCTTGG + Intronic
1173026636 20:39313406-39313428 GGGAGGAGGAATCTGAGCCTTGG + Intergenic
1174055466 20:47795272-47795294 GGGCTCAGGGAGCTGCGCCAAGG - Intergenic
1175121470 20:56719283-56719305 CAGATGAGGAAGCTGAGCCTTGG + Intergenic
1175137598 20:56836523-56836545 GGGCTTAGGATGCTGAGGCCAGG + Intergenic
1175193021 20:57224114-57224136 GGACCCAGGAAACTGAGCCCAGG + Intronic
1175261167 20:57675109-57675131 GGGATAAGGAATCTGAGGCTCGG + Intronic
1175925014 20:62467237-62467259 GGGCTCAGGAATCTGAACTGAGG + Intronic
1176085030 20:63292039-63292061 TGCCTCTGGAGGCTGAGCCTGGG + Intergenic
1176218591 20:63959539-63959561 GGCCTGAGGAAGCGGAGCCGGGG + Exonic
1176263539 20:64196288-64196310 GGGATCACCAAGGTGAGCCTGGG + Intronic
1176381874 21:6117774-6117796 GGGGCCAGGAGGCTGAGCCAGGG - Intronic
1177210273 21:18062317-18062339 GTACTCAGGAAGCTGAGGCATGG - Intronic
1177330558 21:19655009-19655031 GCTCTCAGGAAGCTGAGGCAGGG + Intergenic
1178640653 21:34342708-34342730 TGGCTCAGCAGGCTGAGTCTGGG - Intergenic
1178978624 21:37242472-37242494 GTGCTCAGGAAGCTGAGGGCAGG + Intronic
1179584331 21:42365290-42365312 GGGCGCAGGCAGATGGGCCTGGG + Intronic
1179741598 21:43420465-43420487 GGGGCCAGGAGGCTGAGCCAGGG + Intronic
1180049422 21:45324506-45324528 TGGGTCAGGAAGCTGGGTCTGGG + Intergenic
1180876387 22:19177073-19177095 GGGCTCAGGGACCTGGGCCAGGG - Intronic
1180934925 22:19619189-19619211 GTGACCAGGAAGCTGTGCCTAGG + Intergenic
1180994991 22:19961117-19961139 GGGCTCAGGTATCTGGACCTTGG + Intronic
1181323444 22:22026042-22026064 GGGCTTAGGAAGCAGAGCCTGGG + Intergenic
1181343335 22:22199845-22199867 GGGCTCAGGTAGATGAGCCAGGG - Intergenic
1181408886 22:22704296-22704318 GGGCTCAGGAGGCAGAGCTGTGG + Intergenic
1181422534 22:22811749-22811771 GGGCTCAGGAGGCAGAGCTCTGG + Intronic
1181426983 22:22850137-22850159 GGGCTCAGGAGGCAGAGCTCTGG + Intronic
1183298005 22:37043476-37043498 GAACCCAGGAAGCTGATCCTTGG + Intergenic
1183545207 22:38451773-38451795 GGGCGGAGGAAGCAGAGCCAGGG - Intronic
1184092086 22:42298202-42298224 AGTCGCTGGAAGCTGAGCCTTGG - Intronic
1184241370 22:43212753-43212775 GGGTGCAGGAAGCTGGGCCCTGG + Intronic
1184340162 22:43881563-43881585 GGGCCCAAGGAGCTGGGCCTTGG + Exonic
1184791202 22:46701250-46701272 GGGCACGGGCAGCTGTGCCTGGG - Intronic
1185024724 22:48402375-48402397 GGCCTGAGGACGCTGAGACTTGG - Intergenic
1185109674 22:48894021-48894043 AGGCACAGGGAGCTGAGCCCGGG + Intergenic
1185335296 22:50268582-50268604 GGGCTCAGGAAGCTGGTGCAGGG - Intronic
1185393888 22:50577245-50577267 CAGCTCAGGAACCTCAGCCTTGG + Intronic
950015894 3:9754721-9754743 CATCTCAGGAAGCTGGGCCTGGG + Exonic
950016665 3:9759408-9759430 GTGCTGTGCAAGCTGAGCCTGGG + Intronic
950280672 3:11705231-11705253 GAGCTCGGGAAGCTGAGCGCAGG + Intronic
950521521 3:13500590-13500612 GCTCTCAGGAACCTGTGCCTCGG - Intronic
950628590 3:14266672-14266694 GGACTGAGGAGGCTGGGCCTTGG + Intergenic
950734970 3:14999377-14999399 CTGCTCAGGAAGCTGAGGTTGGG + Intronic
953108381 3:39908254-39908276 GGGCTGTGGCAGCTGCGCCTGGG - Intronic
953718425 3:45335296-45335318 GAGCTGAGGAAGCTGATCATGGG + Intergenic
953721366 3:45358272-45358294 AGGCTGAGGTAGCTGAGCCCAGG - Intergenic
953831730 3:46303489-46303511 TGGCTCAGGAAGCTCACCCCGGG + Intergenic
954153467 3:48671550-48671572 GTCCTCAGGAAGCTGAGGCAGGG - Intergenic
954216986 3:49130188-49130210 GGGGAGAGAAAGCTGAGCCTGGG - Intronic
954622687 3:52005013-52005035 CAGATGAGGAAGCTGAGCCTTGG - Intergenic
956347333 3:68295088-68295110 GGGCTCAGGAGGTTGAGCGAAGG - Intronic
957054889 3:75435575-75435597 GGGCTCAGGAGGCGGGGCCGGGG + Intergenic
957140908 3:76355419-76355441 TGGCTGAGGAAGCTGAGACTTGG + Intronic
958270936 3:91498775-91498797 GAGTTCAAGTAGCTGAGCCTGGG + Intergenic
960651062 3:119950728-119950750 GGGCTCTGGAAACTGAGCAAAGG + Intronic
961299944 3:125916099-125916121 GGGCTCAGGAGGCGGGGCCAGGG - Intergenic
961528119 3:127520837-127520859 CTGCTCAGGAGGCTGAGCCCAGG + Intergenic
961790832 3:129375617-129375639 TGGCTCATGTAGCTGAACCTGGG + Intergenic
961888560 3:130111974-130111996 GGGCTCAGGAGGCGGGGCCGGGG + Intronic
962227814 3:133630959-133630981 GGGCTCAGGCAGTTCTGCCTTGG - Intronic
962371227 3:134822320-134822342 GGGCCCAGGAAGCCTAGGCTGGG - Intronic
962881924 3:139586513-139586535 GCCCTCAGGAAGGAGAGCCTGGG - Intronic
963245989 3:143063159-143063181 GGCCTCAGGAAGCTTAGTCATGG - Intergenic
966891642 3:184411595-184411617 AGGCACAGGATGCAGAGCCTTGG - Intronic
967174744 3:186853050-186853072 GGGCTCAGGATGCTGTTGCTGGG + Exonic
967979419 3:195056717-195056739 GGGTTCAGGTTGCAGAGCCTGGG - Intergenic
968872953 4:3250741-3250763 CGGGTCAGGCAGGTGAGCCTGGG + Intronic
968977210 4:3828188-3828210 GAGCCCAGAGAGCTGAGCCTGGG - Intergenic
968997705 4:3955882-3955904 GGGCTCAGGAGGCGGGGCCAGGG + Intergenic
969599860 4:8169923-8169945 CAGCTCAGAAGGCTGAGCCTTGG - Intergenic
969627717 4:8316247-8316269 CGGCCCATGAAGCTGAGCCGAGG - Intergenic
969816628 4:9691969-9691991 GGGCTCAGGAGGCGGGGCCGGGG - Intergenic
970178014 4:13358844-13358866 CAGATCAGGAAGCTGAGACTTGG - Intergenic
971223154 4:24727409-24727431 GGGCTGAGGAAACTGAGGCCCGG + Intergenic
971619202 4:28832159-28832181 TGGCTCAGAAAGCTGAGTCTAGG - Intergenic
972317251 4:37938390-37938412 GTGCCCAGGAAGCAGTGCCTAGG + Intronic
972913586 4:43848561-43848583 CAGATTAGGAAGCTGAGCCTGGG + Intergenic
973023920 4:45241917-45241939 GAGCTCAGGAGTTTGAGCCTGGG - Intergenic
975588575 4:75977275-75977297 GGGTTCTGGAACCAGAGCCTGGG + Intronic
976948916 4:90804763-90804785 GGAGTCAGGAAACTGAACCTGGG + Intronic
977711487 4:100131486-100131508 GTGCTCCTGAAACTGAGCCTGGG - Intergenic
978825563 4:113018668-113018690 AGGCACAGGAACCTGAGCATGGG + Intronic
980146211 4:128987075-128987097 AGGCTTAGGAATCTAAGCCTAGG + Intronic
983269189 4:165540938-165540960 CAGATCAGGAATCTGAGCCTTGG + Intergenic
983290947 4:165804445-165804467 GAGCCCAGTAAGCTGAGCCAGGG - Intergenic
985094534 4:186400560-186400582 GGGCTCTGGGACCTGGGCCTGGG + Intergenic
985863913 5:2496393-2496415 GGGCTCTGGAAGCTGGGAGTCGG - Intergenic
986712756 5:10499696-10499718 GTGCTTAGGAAGCTGGGCCCAGG + Intergenic
987401873 5:17486351-17486373 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987403118 5:17498349-17498371 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987405299 5:17518485-17518507 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987405744 5:17521919-17521941 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987406191 5:17525353-17525375 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987406638 5:17528787-17528809 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987407508 5:17585618-17585640 GGGATCAGGAAGGTGAGCTCAGG - Intergenic
987407759 5:17587383-17587405 GGGATCAGGAAGGTGAGCTCAGG - Intergenic
987408206 5:17590820-17590842 GGGATCAGGAAGGTGAGCTCAGG - Intergenic
987408654 5:17594254-17594276 GGGATCAGGAAGGTGAGCTCAGG - Intergenic
987409110 5:17597688-17597710 GGGATCAGGAAGGTGAGCTCAGG - Intergenic
987412887 5:17632206-17632228 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
987413162 5:17634578-17634600 GGGCTCAGGAATGTGAGCTCAGG + Intergenic
987414546 5:17649164-17649186 GGGATCAGGAAGGTGAGCTCAGG + Intergenic
988183199 5:27825126-27825148 GTACTCAGGAAGCTGAGGCTGGG + Intergenic
990613635 5:57485083-57485105 GGGCTCTGGAAGCTGTGAGTAGG + Intergenic
991408780 5:66326861-66326883 CTACTCAGGAGGCTGAGCCTGGG + Intergenic
992076118 5:73194161-73194183 TGGCCCAGGAAACTGATCCTGGG - Intergenic
992510359 5:77426855-77426877 GGCCACAGGAAGCAAAGCCTTGG + Exonic
992546676 5:77820571-77820593 TGGCACAGGTTGCTGAGCCTTGG + Intronic
993916020 5:93743059-93743081 GGGCCCAGGAAGATGAGGCTAGG - Intronic
995217601 5:109613494-109613516 GGGCTCCGGAAGGTCATCCTTGG + Intergenic
995831212 5:116358176-116358198 GGGCTGAGGAGGCAGGGCCTTGG - Intronic
997611772 5:135220599-135220621 TGGTTCAGGAAGCTGACTCTGGG - Intronic
997972346 5:138413843-138413865 GGGCTCAGGAACTTGAGCCCAGG - Intronic
998128175 5:139637991-139638013 GGGCTCAGGAGGGTGAGGGTGGG - Intergenic
999241882 5:150132645-150132667 GCTCTCAGAAAGCTGGGCCTAGG + Intronic
1000303722 5:159977335-159977357 AGGCTCAGGGAACTCAGCCTGGG + Intergenic
1000545754 5:162599431-162599453 GAGCTCAGGAGTTTGAGCCTGGG - Intergenic
1001380627 5:171304283-171304305 AGCCTGAGGAAGCTGACCCTAGG - Intergenic
1001636027 5:173211113-173211135 GCGCCCAGGGAGCTGAGGCTGGG + Intergenic
1001749883 5:174120784-174120806 GGGCTCAGGAAGCTGAGCCTGGG - Intronic
1001915846 5:175559417-175559439 GGACTCAGGAGGCTGAGGCAGGG - Intergenic
1001993320 5:176134625-176134647 GGGCCTAGGAACCTGAGCCTGGG + Intergenic
1002000951 5:176195995-176196017 GGGCCCAGGAAGCTGGGCCTGGG + Intergenic
1002253383 5:177942977-177942999 GGGCCCAGGAAGCTGGGCCTGGG - Intergenic
1002483980 5:179522487-179522509 GTCCTCAGGCAGCTGAGCCCTGG - Intergenic
1002498595 5:179632798-179632820 CTACTCGGGAAGCTGAGCCTGGG - Intronic
1002709602 5:181187251-181187273 CTACTCAGGAAGCTGAGCCCAGG - Intergenic
1002915317 6:1524082-1524104 GAGCTCCGGAAGCCCAGCCTGGG + Intergenic
1003882157 6:10488462-10488484 GGGGTCAGGTACCTAAGCCTGGG - Intergenic
1004955606 6:20724604-20724626 CTACTCAGGAGGCTGAGCCTGGG + Intronic
1004968382 6:20880364-20880386 CTACTCAGGAAGCTGAGGCTGGG - Intronic
1006276987 6:33012531-33012553 GAGCTCAGGAGGATAAGCCTGGG - Intergenic
1006318688 6:33305994-33306016 GAGATTAGGAAGCTGAGCCATGG - Intronic
1006520974 6:34570998-34571020 TGCCTGAGGAAACTGAGCCTGGG - Intergenic
1006735157 6:36268116-36268138 GGTCTCAAGATGCAGAGCCTTGG - Intronic
1007055232 6:38876630-38876652 GGGCTCAGGAAGTGGAAACTGGG + Intronic
1007507126 6:42344223-42344245 GAGATGAGGAAGCTGAGGCTTGG - Intronic
1007693094 6:43715591-43715613 GGGCACAGGATAATGAGCCTGGG - Intergenic
1007695262 6:43728198-43728220 CTACTCAGGAAGCTGAGCCTGGG + Intergenic
1007922789 6:45626008-45626030 GGGCTGAGTTAGCTGACCCTTGG + Intronic
1008089279 6:47277102-47277124 GTACTCAGGAGGCTGAGGCTGGG - Intronic
1008984207 6:57522557-57522579 GAGTTCAAGTAGCTGAGCCTGGG - Intronic
1009172263 6:60415434-60415456 GAGTTCAAGTAGCTGAGCCTGGG - Intergenic
1009450941 6:63799975-63799997 GGAGTCGAGAAGCTGAGCCTGGG + Intronic
1010197220 6:73252151-73252173 CTGCTCAGGAAGCTGAGGCATGG - Intronic
1012552886 6:100480662-100480684 GGGCCCAGTAGGCTGAGGCTGGG - Intergenic
1013594819 6:111650879-111650901 GGACTCAGGAAGCTGCCACTGGG + Intergenic
1015739496 6:136438477-136438499 GGGTTCAGGAACCTGAGTGTAGG + Intronic
1016241494 6:141936540-141936562 GGGCTCAGGAAGAAGAGCCCTGG - Intergenic
1017512312 6:155125158-155125180 ATGCTCAGGAAGCTGAGGCAGGG + Intronic
1018613370 6:165663133-165663155 GCGCTCCGGCGGCTGAGCCTCGG + Intronic
1018719749 6:166563495-166563517 GCACTCAGGAGGCTGAGGCTGGG - Intronic
1018945827 6:168346141-168346163 TGGCTCTGGGGGCTGAGCCTGGG - Intergenic
1019704343 7:2490359-2490381 GGGGGCAGGAGGCTGAGGCTGGG - Intergenic
1020235197 7:6349662-6349684 CTACTCAGGAGGCTGAGCCTGGG - Intergenic
1020862504 7:13512291-13512313 GTACTCAGGAAGCTGAGACAGGG + Intergenic
1021195881 7:17673870-17673892 GGGCTCAGGAAGCTAAGACGAGG + Intergenic
1021602948 7:22382339-22382361 CTACTCAGGAGGCTGAGCCTGGG + Intergenic
1021608978 7:22438212-22438234 GAGCTCAGGATGCTGTTCCTTGG - Intronic
1022471381 7:30683526-30683548 GGGCTCGGGAAGCAGGGCCTGGG + Intronic
1023821981 7:43985600-43985622 GAGCTCAGGTGCCTGAGCCTGGG - Intergenic
1023878881 7:44307469-44307491 GGTTTCAGGAGGCTCAGCCTGGG + Intronic
1024228482 7:47346305-47346327 AGACTCAGGAAGCTGAGCCTGGG - Exonic
1025086176 7:56025368-56025390 CTGCTCAGGAGGCTGAGCCAGGG - Intronic
1025237106 7:57242020-57242042 GAGCTCAGGAGTTTGAGCCTGGG - Intergenic
1025237518 7:57244859-57244881 GGGCTCAGGGAGCTGCACCAAGG + Intergenic
1026226741 7:68448585-68448607 GGGCTCTGGAAGCCATGCCTGGG - Intergenic
1029345716 7:99977010-99977032 GCACTCAGGAAGCTGAGGCAGGG + Intergenic
1029382873 7:100224931-100224953 CGGCTGAGGAAACTGAGGCTTGG - Intronic
1029416565 7:100446764-100446786 ATGCTCAAGAAGCTGAGGCTGGG + Intergenic
1029746145 7:102516788-102516810 GGGGTCAGGCAGCTCAGCCCTGG + Intronic
1029750244 7:102539014-102539036 GAGCTCAGGTGCCTGAGCCTGGG - Intronic
1029764083 7:102615767-102615789 GGGGTCAGGCAGCTCAGCCCTGG + Intronic
1029768195 7:102638122-102638144 GAGCTCAGGTGCCTGAGCCTGGG - Intronic
1031415513 7:121491628-121491650 GAGCTCAGGAGGTTGAGACTGGG - Intergenic
1033033362 7:137847288-137847310 GGGCTCAGGCAGCAGCCCCTGGG + Intergenic
1033058387 7:138081132-138081154 GGGCTCAGGAAGCTCAGAGAAGG - Intronic
1033621899 7:143069407-143069429 GGGCTGGGAAAGCTCAGCCTAGG - Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034150688 7:148912961-148912983 CAGATCAGGAAGCTGAGCCCTGG + Intergenic
1034946257 7:155263657-155263679 GGGCTCAGAAAGCTGATGCCTGG + Intergenic
1035007554 7:155678407-155678429 GGGCACCTGAAGCTGAGCCCAGG + Intronic
1035548139 8:499490-499512 GGGCTCAGGAAGCTGGTGGTGGG - Intronic
1035609102 8:948527-948549 GGGCTCAGGGAGCAGAGCGGAGG - Intergenic
1036379541 8:8228079-8228101 GGGCTCAGGAGGCGGGGCCGGGG - Intergenic
1037492470 8:19409116-19409138 GGGCTCAGGAAGTTGAGAAAAGG + Intronic
1039543461 8:38390108-38390130 CTACTCAGGATGCTGAGCCTGGG + Intronic
1040033510 8:42846600-42846622 GGGCTCAGGAGGCTGAGGCAGGG + Intergenic
1040087198 8:43356453-43356475 GGGCTCAGGAAGATTCCCCTGGG - Intergenic
1040088692 8:43372346-43372368 GGGCTCAGGAAGATTTCCCTGGG - Intergenic
1040405876 8:47101468-47101490 GGGCTCAGGAAGATTTCCCTGGG + Intergenic
1040449103 8:47526146-47526168 AGTGTGAGGAAGCTGAGCCTGGG - Intronic
1040919361 8:52599499-52599521 GGGGTCAGGAATGTTAGCCTTGG + Intergenic
1041068889 8:54107142-54107164 GGGCTCAGGAGGCTGTGGCAGGG + Intergenic
1041181132 8:55249407-55249429 GGTCACATGAAGTTGAGCCTAGG - Intronic
1041693722 8:60714444-60714466 GGCCTCTGGACGCTGAGACTGGG + Intronic
1042593639 8:70422937-70422959 CCACTCAGGAGGCTGAGCCTAGG - Intergenic
1042962071 8:74314557-74314579 GGGCTCAGGAAGATGAGCACAGG + Intronic
1044655673 8:94545846-94545868 GGGTTCAAGAAGATCAGCCTGGG + Intronic
1047954672 8:129964771-129964793 CTACTCAGGAGGCTGAGCCTGGG + Intronic
1048273077 8:133045010-133045032 AGGCACTGGAAGGTGAGCCTCGG + Exonic
1048307347 8:133293415-133293437 GGGCTCAGGAGGCTCACCTTGGG + Intronic
1048778787 8:137978573-137978595 AGGCTCAGGAGGCTGAGGCAGGG + Intergenic
1049205006 8:141359543-141359565 GGGAGCTGGGAGCTGAGCCTGGG - Intronic
1049262239 8:141645988-141646010 GGACTCAGGGAGCACAGCCTGGG - Intergenic
1049432373 8:142571327-142571349 GGGCCCAGGAGACTGAGTCTGGG + Intergenic
1049805036 8:144534865-144534887 GGACTCAGGGACCTCAGCCTGGG + Intronic
1050584869 9:7100181-7100203 GAGCTCAGGATTTTGAGCCTAGG + Intergenic
1052803017 9:32987622-32987644 CTGCTCAGGAAGCTGAGGCTGGG - Exonic
1052817310 9:33111712-33111734 GGGATTAGGCAGCTGAGTCTTGG + Exonic
1054762274 9:69013935-69013957 CGGCTCAGGACGCTGGGCATGGG - Exonic
1054854697 9:69885825-69885847 GAGCTCAGGGACTTGAGCCTGGG + Intronic
1055867472 9:80832577-80832599 GGGTTCATGAAGCAGAGCCTTGG + Intergenic
1056045755 9:82713899-82713921 GGGCTGAGGAAGGGGAGCATTGG + Intergenic
1057200298 9:93136162-93136184 GAGCTGAGGAAACTGAGGCTGGG - Intergenic
1058798409 9:108520508-108520530 GGGCTGTGGAAACTGAGGCTCGG - Intergenic
1059119497 9:111629195-111629217 CTACTCAGGAGGCTGAGCCTGGG - Intergenic
1059206117 9:112467619-112467641 GGTCTCAGGAAGTGGGGCCTTGG - Intronic
1060386572 9:123234895-123234917 GGTCGCAGTCAGCTGAGCCTGGG + Intronic
1060549477 9:124478191-124478213 GGGCTCTGGGAACTGAGGCTTGG - Intronic
1061484370 9:130912899-130912921 GGGCTCTGGAGGCCAAGCCTGGG - Intronic
1061973930 9:134058936-134058958 GGGCACTGGAGGCTGTGCCTTGG + Intronic
1062311292 9:135938846-135938868 GGGCTGATGGAGCTGTGCCTGGG - Intronic
1062475353 9:136724041-136724063 GGGCTCAGGGTGCTCAGCCCTGG - Exonic
1187269237 X:17764976-17764998 GGGCTCAGGCAGGTGTCCCTAGG - Intergenic
1188646033 X:32568395-32568417 CGACTCAGGAAGCTGAGGCAAGG + Intronic
1189422395 X:40867661-40867683 GGGCTCAGGAAGGAGGGCTTAGG + Intergenic
1190690155 X:52907349-52907371 GGCCTCAGTAACCTGAGCCCCGG + Exonic
1190695828 X:52948443-52948465 GGCCTCAGTAACCTGAGCCCCGG - Exonic
1190740276 X:53284037-53284059 GGGCCCAGCATGCAGAGCCTTGG + Intronic
1190909522 X:54758478-54758500 GGCCACAAGAAGCTGATCCTTGG + Exonic
1191869889 X:65736914-65736936 AGGCTCAGCAAGGTGAGGCTTGG + Exonic
1195096950 X:101511834-101511856 GTGCTCAGGAGGCTGAGCGAGGG + Intronic
1195716748 X:107825935-107825957 GGGCGGCGGAAGGTGAGCCTGGG + Exonic
1196483946 X:116182108-116182130 GGGCTTGGGAAGCTGAGCACAGG + Intergenic
1196750162 X:119108749-119108771 CTACTCGGGAAGCTGAGCCTGGG + Intronic
1199677386 X:150199715-150199737 GGCCTCAGGTTGCTGGGCCTGGG + Intergenic
1200786586 Y:7265955-7265977 CTGCTCAGCAAGCTGAGGCTGGG + Intergenic
1201227211 Y:11829759-11829781 CTGCTCAGGAAGCTGAGGCAGGG + Intergenic
1201227849 Y:11835367-11835389 CTACTCAGGAACCTGAGCCTGGG - Intergenic
1202271008 Y:23073886-23073908 GGGCGAAGGATGCTGAGCATGGG + Intergenic
1202295018 Y:23346796-23346818 GGGCGAAGGATGCTGAGCATGGG - Intergenic
1202424003 Y:24707630-24707652 GGGCGAAGGATGCTGAGCATGGG + Intergenic
1202446786 Y:24962455-24962477 GGGCGAAGGATGCTGAGCATGGG - Intergenic