ID: 1001750992

View in Genome Browser
Species Human (GRCh38)
Location 5:174131309-174131331
Sequence ATTCATAAGAATCAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001750987_1001750992 29 Left 1001750987 5:174131257-174131279 CCTAGGAAGGTGCAGTCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 340
1001750990_1001750992 -4 Left 1001750990 5:174131290-174131312 CCTTGAGTAAAGATCATTGATTC 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001750992 Original CRISPR ATTCATAAGAATCAGCAGGA AGG Intronic
902567807 1:17324778-17324800 ATACACAAAAATCAGCTGGAGGG - Intronic
903452631 1:23464864-23464886 ATGCATTAGAATCACCTGGAGGG - Intronic
903672974 1:25047287-25047309 ATTCATATGAATGAGGTGGAGGG + Intergenic
907190260 1:52642180-52642202 ATTCTTAAGAAACAGCAGTATGG + Intronic
908543742 1:65145873-65145895 ATGCATCAGAATCACCTGGAAGG - Intergenic
909762129 1:79303104-79303126 ATTTATGAGAATCAGCAAGGAGG - Intergenic
910102632 1:83594718-83594740 CTTCATAAGAATCAAAAGTAAGG - Intergenic
910367514 1:86482403-86482425 ATTCATAAGAATCTGGGGGAGGG - Intronic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
911935503 1:103965120-103965142 AGACATAAAAATCATCAGGATGG - Intergenic
912993627 1:114511907-114511929 ATACATAAGAATCAGCTGAAGGG - Intergenic
913438751 1:118875065-118875087 ATAAAGAAGAATCAGCAGTAGGG - Intergenic
913458106 1:119054557-119054579 ATACATAAGAATCAAAAGCAGGG + Intronic
913616257 1:120562894-120562916 ATGCATCAGAATCACCTGGAGGG + Intergenic
914574018 1:148948010-148948032 ATGCATCAGAATCACCTGGAGGG - Intronic
915672119 1:157498585-157498607 ATGCATCAGAATCACCTGGAAGG + Intergenic
915793447 1:158700908-158700930 ATGCATCAGAATCACCTGGAGGG + Intergenic
916087294 1:161280797-161280819 ATTAAGAAAAATCAACAGGATGG - Intronic
916780128 1:168017626-168017648 ATTTATGAAATTCAGCAGGAGGG + Intronic
917101141 1:171446577-171446599 ATTCATAAGAATTGGGAGGATGG + Intergenic
917686203 1:177418617-177418639 ATTCATAATAACAACCAGGAGGG - Intergenic
917724867 1:177818700-177818722 ATACATCAGAATCAGCAGGAGGG - Intergenic
918419804 1:184352748-184352770 ATACATCAGAATCACCGGGAGGG - Intergenic
918854119 1:189729020-189729042 ATTCAAAAGACTGAGAAGGAGGG - Intergenic
919356773 1:196534820-196534842 ATTCAGATGATTCAGCAGAAAGG - Intronic
919871457 1:201824908-201824930 GTGCATCAGAATCACCAGGAGGG - Exonic
919994615 1:202737253-202737275 ATGTATAAGAATCATCTGGAAGG + Intronic
920612838 1:207458470-207458492 AGTCAGAAAACTCAGCAGGAGGG - Intronic
921640825 1:217551462-217551484 ATGTGTAAGAATCAGCTGGAAGG - Intronic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922392999 1:225166808-225166830 GTTCCTTAGAATCAGCTGGATGG - Intronic
922523016 1:226273755-226273777 ATGCATCAGAATCACCTGGAGGG - Intronic
924232161 1:241971263-241971285 ATTGAAAAGAAGCAGCAGGCCGG - Intergenic
924284550 1:242472401-242472423 ACTCATAAGAATGATCAGCAGGG - Intronic
1066790766 10:39060575-39060597 TTTCATTTGAATCAGCAGGTTGG - Intergenic
1066794255 10:39101526-39101548 ATTCCTTTGATTCAGCAGGATGG + Intergenic
1066797125 10:39134792-39134814 ATTCTTTAGATTCAGCAGGTTGG + Intergenic
1068050894 10:51947610-51947632 ATTTAAAACAAACAGCAGGAGGG - Intronic
1069252749 10:66291313-66291335 ATGCATCAGAATCACCAGAAAGG + Intronic
1070051043 10:72890177-72890199 TCTCATCAGAATCACCAGGAGGG - Intergenic
1071436316 10:85651079-85651101 ATGCATCAGAATCACCTGGAGGG - Intronic
1073003785 10:100305858-100305880 ATGCATCAGAATCACCTGGAAGG + Intronic
1073591645 10:104763202-104763224 ATGCGTAAGAATCACCTGGAGGG - Intronic
1074960120 10:118437052-118437074 ATTCAGAAGAAGCAGCAGTTTGG - Intergenic
1075588124 10:123671991-123672013 AATCATAATAATAAGCAAGAGGG + Intronic
1078863385 11:15274566-15274588 ATTCATTAGAATCAGCTCTATGG + Intergenic
1079008264 11:16807977-16807999 ATGCATCAGAATCAGCCAGAGGG + Intronic
1079635168 11:22728807-22728829 GTTCATGATAATCAGGAGGAAGG + Intronic
1079765421 11:24386504-24386526 ATGCATCAGAATCACCTGGAAGG + Intergenic
1080346248 11:31329007-31329029 ACCCATCAGAATCAGGAGGAAGG - Intronic
1081209008 11:40308903-40308925 ATGCATATGAATCATCAGAATGG + Intronic
1082099142 11:48157482-48157504 ATCCATCAGCATCACCAGGAGGG + Intronic
1082290744 11:50366994-50367016 TTTCATTTGATTCAGCAGGATGG + Intergenic
1084637826 11:70404700-70404722 ATTCATAAGAAACATCATGTAGG + Intronic
1084776010 11:71376111-71376133 ATCCATCAGAATCACCTGGAGGG - Intergenic
1085360416 11:75880096-75880118 AATCAGAAGAATCAACAGAAAGG - Intronic
1085426556 11:76409897-76409919 ACTTATAAGAATGAGCAGGGTGG - Intronic
1085808440 11:79658191-79658213 ATTCATCAGAATTACCTGGAGGG - Intergenic
1087469857 11:98558985-98559007 ATTTATAATAACAAGCAGGAGGG - Intergenic
1087768586 11:102182238-102182260 ATTCATCAGAATCACCTGGAAGG - Intronic
1087986617 11:104690117-104690139 AATCATAATATTCAGCATGATGG - Intergenic
1088037454 11:105334538-105334560 ATTCCTCAGAACCAGCAGGTGGG - Intergenic
1088707373 11:112475929-112475951 ATCGATTAGAAGCAGCAGGAAGG - Intergenic
1088930949 11:114350240-114350262 ATGCATCAGAATCACCTGGAGGG - Intergenic
1089063558 11:115645486-115645508 ATTAATAAGCATCGACAGGATGG + Intergenic
1089947373 11:122490869-122490891 GTGCATAAGAATCATCTGGAGGG + Intergenic
1090734460 11:129598886-129598908 ATTCATCAGAACTAACAGGAAGG - Intergenic
1091139006 11:133219523-133219545 ATGGATAAGAATCATCCGGAGGG + Intronic
1091414712 12:271332-271354 AACCAAAAGAAGCAGCAGGAGGG - Intergenic
1091874519 12:3922721-3922743 ATGCATCAGAATCAGTTGGAGGG + Intergenic
1092351364 12:7758564-7758586 ATGCATAATAATCCCCAGGAAGG - Intergenic
1092461943 12:8694693-8694715 ACACATGAGAATCAACAGGAGGG - Intronic
1092607652 12:10137629-10137651 ATTCAAAAGATTCAGGAGAAGGG + Intergenic
1093285423 12:17253907-17253929 ATTTATAAGAATCAACTGGGTGG + Intergenic
1093712913 12:22347996-22348018 TATCATAAGAATCAGGAGGGAGG + Intronic
1095047581 12:37525246-37525268 ATTCTTTTGATTCAGCAGGATGG - Intergenic
1095081724 12:38008026-38008048 TTTCTTTAGAATCAGCAGGTTGG + Intergenic
1096408029 12:51357885-51357907 ATGCATCAGAATCACCAGGAAGG - Intronic
1097576129 12:61394789-61394811 ATTCAGTAGAAACAGCAGAAGGG + Intergenic
1098549711 12:71749830-71749852 ATGAATAAGAATCACAAGGAGGG + Intergenic
1098829769 12:75347392-75347414 ATTTATAAGAATTACCAGTAAGG + Intronic
1099093648 12:78343890-78343912 ATCCACAAGAAACAGCAGTAGGG + Intergenic
1100717094 12:97317447-97317469 ATTGATAGGAATCACTAGGAGGG + Intergenic
1101760234 12:107652288-107652310 ACACATCAGAATCAGCTGGAGGG - Intronic
1104183489 12:126405454-126405476 ATTCATTAGAATCAAAAGGTAGG - Intergenic
1104617602 12:130283579-130283601 GTTCATTAGAACCACCAGGAAGG - Intergenic
1106274487 13:28190970-28190992 TTTCATAATAACCAGCAAGATGG + Intronic
1106607679 13:31245821-31245843 ATTCAGAAGTAACAGTAGGAAGG + Intronic
1106742420 13:32660134-32660156 ATTCAGAAGGTGCAGCAGGAAGG - Intronic
1107276099 13:38681011-38681033 ATTCAAAAGTCTAAGCAGGATGG - Intergenic
1107547545 13:41447700-41447722 ATTCGTAAAAATCAGTAGTAAGG - Intergenic
1107626887 13:42296149-42296171 ATTTTTAAGAAGCAGCACGAGGG - Intronic
1111947744 13:94683215-94683237 ATTCACAAAAATGAGAAGGATGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1111974633 13:94952664-94952686 AATCATGAGAGTCAGTAGGATGG - Intergenic
1112971018 13:105262637-105262659 ATTCACAAGAAACTGCAGGATGG + Intergenic
1113138902 13:107125319-107125341 ATTAATAAGGATCACCTGGATGG + Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114345774 14:21793160-21793182 ATTCATAAGACTCAGAGAGAGGG - Intergenic
1115789760 14:36865699-36865721 CTGCATAAGAATCACCAGGGAGG + Intronic
1117093909 14:52277801-52277823 ATGCATGAGAATCACCTGGAGGG - Intergenic
1117785853 14:59284084-59284106 AAGCATCAGAATCACCAGGAAGG - Intronic
1118099982 14:62587092-62587114 ATTCAAAGCAAGCAGCAGGAAGG - Intergenic
1118426516 14:65669866-65669888 ATGCATGAGAATCATCTGGAAGG + Intronic
1118846080 14:69548774-69548796 ATTCACTAGCATGAGCAGGAAGG + Intergenic
1119625388 14:76170016-76170038 ATGCATCTGAAGCAGCAGGAGGG - Intronic
1119724232 14:76912491-76912513 ACCCAAAAGAATCAGCAGGAAGG + Intergenic
1120653767 14:87165228-87165250 ATGCCTCAGAATCACCAGGAGGG + Intergenic
1120931229 14:89850493-89850515 GTGCATAAGAATCACCTGGAAGG - Intronic
1122940503 14:104978929-104978951 CTTGACAAGAATCAGCAGAAAGG - Intergenic
1124904972 15:33859640-33859662 TTTCATAAGGATCACCAGCAGGG - Exonic
1125359193 15:38848028-38848050 ATTTAAAAGAATCACCAGGCTGG + Intergenic
1130016862 15:80194178-80194200 ATGCATTAGAATCACCGGGACGG - Intergenic
1132326706 15:100976515-100976537 TTTGATAAAAATCAGAAGGAAGG + Intronic
1133004921 16:2874677-2874699 ATCCAAAAAAATCAGCGGGACGG + Intergenic
1136052731 16:27664300-27664322 ATTCATAAAAATCATCTGGTAGG - Intronic
1137073790 16:35935931-35935953 ATTCTTTTGAATCAGCAGGTTGG - Intergenic
1138356131 16:56382027-56382049 ATTCAAAAGAATTAGAAGCAGGG + Intronic
1139000336 16:62502414-62502436 CTTCTTAAGAAACAGCAGGCTGG + Intergenic
1139812233 16:69630469-69630491 ATTCTTAAAAATGAGGAGGAGGG - Intronic
1140467728 16:75195883-75195905 ATGCATCAGAATCACCTGGAAGG + Intergenic
1142439287 16:90084604-90084626 ATTTTTAAAAATCAGCAGGCTGG - Intronic
1142715873 17:1746726-1746748 TTGCATAAGAATCACCAGGAGGG - Intronic
1143841520 17:9735796-9735818 ATTCAAAAGCTTCAGCAGGCAGG - Intergenic
1143940143 17:10532090-10532112 ATGCATAAGAATCACCTGAAGGG + Intronic
1144060427 17:11579216-11579238 ATTCATAGGCCTCAGGAGGAAGG - Intergenic
1144406825 17:14959980-14960002 CTGCATAAGAATCACCTGGAAGG - Intergenic
1144488926 17:15691258-15691280 GTTCATAGTAATCAGCAGGAAGG - Intergenic
1144715927 17:17435872-17435894 ATTCTTAAGAATCAGGAAGTGGG + Intergenic
1144912094 17:18691045-18691067 GTTCATAGTAATCAGCAGGAAGG + Intergenic
1147551524 17:41446005-41446027 ATTCCTTAGAATCACCTGGATGG - Intergenic
1148446701 17:47742478-47742500 ACTCACAAGAACCAGCTGGAAGG - Intronic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1149455477 17:56784570-56784592 ATGCATCAGAATCACCAGGAGGG + Intergenic
1149954487 17:61033221-61033243 ATGCATCAGAATCATCTGGAGGG + Intronic
1150526685 17:65931153-65931175 ATTCTTAAGGATGAGGAGGAGGG + Intronic
1152447870 17:80356296-80356318 ATTCAAAAGCATCAACAGGCCGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1155034027 18:22009013-22009035 ATCCACTAGAATCAGGAGGATGG - Intergenic
1155629021 18:27869588-27869610 ATTCATATGAATCTGAATGAGGG + Intergenic
1155728040 18:29114513-29114535 ATACATAAAAATAAGCAAGATGG + Intergenic
1156014345 18:32531188-32531210 TTTCATCAGAATCACCAGTATGG - Intergenic
1156628854 18:38942898-38942920 ATTCATGAAAATCATCAGAAGGG - Intergenic
1157782889 18:50455995-50456017 ATTGATAAGAATCATCTGGTTGG + Intergenic
1157928508 18:51792564-51792586 ATTTATAAAAATCAGTAGGAGGG + Intergenic
1158745961 18:60200519-60200541 AATCCTAAGAATCACCTGGAGGG - Intergenic
1158866887 18:61646525-61646547 AGGCAGAAGAAACAGCAGGAGGG + Intergenic
1159467418 18:68802827-68802849 TTTCAAAAGAATCAGCAGATGGG - Intronic
1167332321 19:48863907-48863929 GTGCATAAGAATCACCAGGAAGG + Intronic
927143007 2:20142430-20142452 ATGCATCAGAATCATCTGGAGGG - Intergenic
927813770 2:26195879-26195901 ACGCATCAGAATCACCAGGAGGG - Intronic
928368566 2:30722248-30722270 ATTCAAAAGCATTAGCAAGAGGG + Intergenic
928867704 2:35937116-35937138 AATCTTGAGAATCAGGAGGATGG - Intergenic
929267843 2:39939045-39939067 GTGCATAAGAATCATCTGGAGGG + Intergenic
929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG + Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
935653663 2:105403631-105403653 AGTCATCAGAATCACCTGGAGGG - Intronic
936980880 2:118264092-118264114 GTTCATTGGAATCAGGAGGATGG - Intergenic
937192030 2:120111476-120111498 ATGCATCAGAATCTCCAGGAGGG - Intronic
938913680 2:135912043-135912065 ATGCATCAGAATCACCTGGAGGG - Intronic
939011252 2:136848281-136848303 ATGCATCAGAATCACCTGGAAGG + Intronic
939608529 2:144281977-144281999 ATTCAAAAGAATCACCCGGAAGG + Intronic
939842820 2:147209006-147209028 ATGCATAAAAATCAACTGGAGGG - Intergenic
940112049 2:150165812-150165834 ACTCATATTAAGCAGCAGGAAGG + Intergenic
940384163 2:153050776-153050798 ATGCATCAGAATCACCTGGAGGG + Intergenic
941552092 2:166929180-166929202 ATGCATTAGAATCATCTGGAGGG - Intronic
941711457 2:168718478-168718500 ATGCAGCAGAATCATCAGGAAGG - Intronic
941850283 2:170173410-170173432 ATTCATCAGAATCTTCTGGAGGG - Intergenic
942523560 2:176829637-176829659 ATTCATCAGATTCACCTGGAGGG - Intergenic
942765822 2:179455386-179455408 AATCATGAGAACCAGCAGCATGG - Intronic
943287905 2:186028176-186028198 ATTCATCAAAATCCACAGGAAGG + Intergenic
943458679 2:188141572-188141594 CATGATAAGAATGAGCAGGAAGG + Intergenic
944415286 2:199473688-199473710 ATTTTTAAGAACCAACAGGAAGG + Intergenic
944899860 2:204203162-204203184 ATGCATCAGAATCACCTGGAAGG + Intergenic
946208169 2:218125880-218125902 ATTCAACAGAAACAGAAGGAGGG + Intronic
946376730 2:219314496-219314518 ATGCATTAGAATCACCTGGAGGG - Intergenic
947081696 2:226404955-226404977 ATTCATTAGAATCATAAGGTTGG + Intergenic
947535235 2:230935966-230935988 AGTCATCAGTATCAGCATGAGGG + Intronic
1169257212 20:4108730-4108752 ACGCATTAGAATCAGCGGGAGGG - Intergenic
1169839259 20:9916429-9916451 ATACATTAGAATCACCAAGAGGG - Intergenic
1170091664 20:12595967-12595989 ATGCATAAGAATCACCTGGGAGG + Intergenic
1171798898 20:29591181-29591203 ATTCTTTTGACTCAGCAGGATGG + Intergenic
1171845165 20:30265380-30265402 ATTCTTTTGATTCAGCAGGATGG - Intergenic
1171964569 20:31519654-31519676 ATGCATCAGAATCACCAGGTGGG - Intronic
1173178883 20:40786614-40786636 ATGCAGAAGAGGCAGCAGGATGG - Intergenic
1173311621 20:41901354-41901376 ATGCATCAGAATCACCTGGAGGG - Intergenic
1173454909 20:43194142-43194164 ATGCATGAGAATCACCTGGAAGG - Intergenic
1174207044 20:48847808-48847830 ATTTATAGAAATCAGAAGGATGG - Intergenic
1177758862 21:25380073-25380095 ATTCATTAGAAGCAGCAGAATGG - Intergenic
1178164148 21:29952867-29952889 AGTGATGAGAACCAGCAGGAAGG + Intergenic
1178733427 21:35127013-35127035 AAGCATAAGAATGAGCAGAATGG + Intronic
1179199407 21:39202368-39202390 ATTCAGCAGAATCATCAGAAAGG - Exonic
1180743119 22:18067540-18067562 CCTCATAAGGATCAGGAGGAGGG - Intergenic
1181583431 22:23840218-23840240 ATTCAAAAGAATCAAAAGCAGGG + Intergenic
1182065404 22:27428039-27428061 TCTCATAAGAATCTTCAGGAGGG - Intergenic
1182520625 22:30882597-30882619 TGGCATCAGAATCAGCAGGAGGG + Intronic
1182869570 22:33634240-33634262 ATGCATCAGAATCACCTGGAGGG + Intronic
1183093089 22:35536720-35536742 TTGCATCAGAATCACCAGGAGGG + Intergenic
1184313153 22:43661726-43661748 ATTCATGTGAATTACCAGGAAGG - Intronic
1184953324 22:47861814-47861836 ATTTATCAGAAACAGTAGGAGGG + Intergenic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
949317712 3:2775244-2775266 ATTCATAAGAATGAACTGGCTGG - Intronic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
950282246 3:11718799-11718821 ATTAATAAGAACCAGCAGCCTGG - Intronic
950568080 3:13783213-13783235 ATTCAACAGAAACAGCAGGCTGG - Intergenic
951264629 3:20551642-20551664 ATGCATCAGAATCACCTGGAGGG - Intergenic
952427284 3:33188476-33188498 ATGCATCAGAATCACCTGGAAGG + Intronic
952665584 3:35900275-35900297 CTTCTCAAGAAACAGCAGGAGGG + Intergenic
952746848 3:36789791-36789813 GTACATCAGAATCATCAGGAGGG + Intergenic
956308876 3:67857051-67857073 ATGTATCAGAATCACCAGGATGG - Intergenic
957974722 3:87428819-87428841 TTTCACAAGAAGCAGAAGGATGG - Intergenic
958684318 3:97373045-97373067 TTTCATAATAAACAGAAGGATGG + Intronic
958910447 3:99987961-99987983 ATTCTTAAGAAACAGAATGATGG - Intronic
958920860 3:100103902-100103924 ATTAATAAGAATCATGAGCACGG + Intronic
959383627 3:105673994-105674016 ATGCATCAGAATCACCAGGAAGG + Intronic
960480751 3:118186139-118186161 TTTTATTAGAATCATCAGGAAGG + Intergenic
960535009 3:118805841-118805863 ATGTATAAGAATCACCTGGAAGG - Intergenic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
961051066 3:123747484-123747506 ATGCATCAGAATCACCCGGAGGG - Intronic
961144145 3:124580205-124580227 ATACATCAGAATCACCTGGAGGG - Intronic
961996598 3:131251737-131251759 AGTCATAAGAAGCAGTAGAAGGG - Intronic
962246701 3:133801394-133801416 ATTCTCAGGAATGAGCAGGAGGG - Intronic
962502522 3:136009717-136009739 ATGCATCAGAATCACCCGGAGGG - Intronic
962699795 3:137986172-137986194 CTTCATAAGAACCAAAAGGAAGG - Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
964686220 3:159398788-159398810 ATTCATAAGAATGAGAAGTCTGG + Intronic
964802995 3:160574668-160574690 ATGCATTAGAATCACCTGGAAGG + Intergenic
964825735 3:160825965-160825987 ATTCAAAAGTCTGAGCAGGAAGG - Intronic
965749308 3:171959744-171959766 ATTGCTGAGAGTCAGCAGGAGGG + Intergenic
966680129 3:182632975-182632997 AATCATAAGATTGAGCAGAAAGG - Intergenic
969230225 4:5825417-5825439 TTTCCTCAGAAGCAGCAGGAAGG + Intronic
970731631 4:19111370-19111392 ATGTATCAGAATCAGCTGGAAGG + Intergenic
970897953 4:21125145-21125167 GTGCATCAGAATCAGCAGGAGGG + Intronic
971588445 4:28435332-28435354 ATTGAAAAAAATCAGAAGGATGG - Intergenic
972171478 4:36350783-36350805 GTTCACAAGAATAAGCAGGGTGG + Intergenic
972353801 4:38261612-38261634 ATTCATCAGGATGGGCAGGATGG - Intergenic
972854358 4:43089011-43089033 CTACATAAGACTCAGCAGAAAGG + Intergenic
972939145 4:44176210-44176232 ATAAATCAGAATCAGGAGGAAGG + Intronic
974350892 4:60744667-60744689 GTTCATAGGAATCAGAAGGATGG - Intergenic
974738590 4:65974653-65974675 AATGATAACATTCAGCAGGATGG - Intergenic
976303231 4:83535353-83535375 ATTTTTAAGAATGAGCAGAAGGG - Intergenic
976491333 4:85674119-85674141 ATTCATCAGAACCATCTGGAGGG + Intronic
976727086 4:88225312-88225334 ATTTATAAAAATAAGCAGGAAGG + Intronic
976833223 4:89339299-89339321 ATTCCTAAGAATCATCAACAGGG - Intergenic
977835713 4:101644050-101644072 AATCATAAGAATCAAAATGATGG - Intronic
977888934 4:102284246-102284268 ATTCAGAAGGGTGAGCAGGAGGG - Intronic
977935201 4:102794132-102794154 ATTCATCAGAATCACTTGGAGGG + Intergenic
978227386 4:106353483-106353505 TTTCATAAGAATCAGCATAGTGG - Intergenic
979341520 4:119530025-119530047 ATTCATCAGAATCACCTGGAAGG - Intronic
979533614 4:121795177-121795199 GTTTATAAGAATCACCTGGAGGG + Intergenic
980753795 4:137129331-137129353 ATTCATAAGAATTACTAGTACGG - Intergenic
980923032 4:139106028-139106050 ATACATAAGAATTATCAGAAGGG - Intronic
981672422 4:147302099-147302121 CTGCATAAGAATCACCTGGAAGG + Intergenic
981800851 4:148653824-148653846 ATTCTTATGAGTCAGCAAGATGG - Intergenic
982273137 4:153611972-153611994 ATTCATAATAACCAGAAGGTGGG - Intronic
983507888 4:168575146-168575168 ATGCATCAGAATCACCTGGAGGG + Intronic
985826534 5:2195712-2195734 ATTCCTAAGAATTAGCAGAGGGG - Intergenic
987032960 5:13992369-13992391 AGACATAAGAATGAGAAGGAAGG + Intergenic
987539766 5:19239236-19239258 ATTTTTAAAAATCACCAGGAAGG + Intergenic
987607253 5:20153230-20153252 ATTCACAAGAATCATCAGGCTGG - Intronic
987844182 5:23260174-23260196 ATTCATCAGAATCACCAGGAGGG - Intergenic
988462474 5:31452546-31452568 ATTCATCAGAACCTGGAGGATGG + Intronic
988489602 5:31695186-31695208 ACTTGGAAGAATCAGCAGGATGG - Intronic
988735892 5:34020930-34020952 AGTCATAAGAAGGAGCAGGGAGG - Intronic
989021953 5:37018168-37018190 ATTCATTAGAATCACCTGGAGGG - Intronic
991008588 5:61857390-61857412 GTGCATCAGAATCATCAGGAAGG - Intergenic
991206276 5:64053420-64053442 CATCATTAAAATCAGCAGGAGGG + Intergenic
992273316 5:75088457-75088479 AATCATAAGAATCATAAGAATGG - Intronic
993002181 5:82392344-82392366 ATTCATAACAACCAGGAGAAAGG + Intergenic
994160045 5:96547343-96547365 AGGCATAAGAACCAGAAGGAAGG + Intronic
994440906 5:99801438-99801460 ATTTATCAGCATCAGCAGCATGG - Intergenic
995713394 5:115057406-115057428 TTGGGTAAGAATCAGCAGGATGG - Intergenic
995929519 5:117421657-117421679 ATATATAGGAATCAGCAAGAGGG - Intergenic
998615245 5:143733353-143733375 ATGCATCAGAATCACCTGGATGG + Intergenic
998745356 5:145252221-145252243 TAACATAAGAATCAACAGGAAGG - Intergenic
999301432 5:150493140-150493162 ATGCATTAGAATCAGCGGGAAGG - Intronic
999888951 5:155956221-155956243 ATTTACCAGAAACAGCAGGAAGG - Intronic
999935482 5:156481415-156481437 AGTCATAAGATTTAGCAAGAAGG - Intronic
1000572592 5:162934059-162934081 ATTCATAAGAAGGAATAGGAGGG - Intergenic
1000703341 5:164480122-164480144 GTGCATTAGAATCACCAGGAGGG - Intergenic
1000951633 5:167490951-167490973 ATTTATCAGAATCTTCAGGATGG + Intronic
1001003603 5:168030429-168030451 ATTCATCCGAATCACCTGGAAGG + Intronic
1001595315 5:172895080-172895102 ATGCAGCAGAATCAGCAAGAGGG + Intronic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1002605518 5:180380694-180380716 GTTCCTGAGAATGAGCAGGAAGG - Intergenic
1003052545 6:2793034-2793056 CTTCCTGAGAGTCAGCAGGATGG + Intergenic
1003243849 6:4367897-4367919 ATGCATCAGAATCATCTGGAAGG + Intergenic
1003373744 6:5554345-5554367 ATTTGGAAGCATCAGCAGGAGGG + Intronic
1003714461 6:8630869-8630891 ATTCAAAAGAAACATCAGGCTGG + Intergenic
1004855917 6:19749726-19749748 ATTCATGAAAATCAGAAGAATGG + Intergenic
1006585642 6:35109378-35109400 ATTCAAAATAAGCAGAAGGAAGG + Intergenic
1008493023 6:52105724-52105746 ATTCAAAAGAATAAACAGCATGG - Intergenic
1009476996 6:64105137-64105159 AATCATCAGAATCTGCAAGATGG + Intronic
1010590319 6:77704650-77704672 ATTCATGAGAATCACCTGGGGGG - Intronic
1012323471 6:97882735-97882757 ATGCATCGGAATCACCAGGAAGG - Intergenic
1013297066 6:108767105-108767127 ATTCAAAAGTCTCAGCAGGCTGG - Intergenic
1013570159 6:111415148-111415170 ATGCATAAGAATCATCAGAAAGG + Intronic
1013989879 6:116241621-116241643 AATATTAAGAATCAGCAAGACGG + Intronic
1014271056 6:119336389-119336411 ATGCATCAGAATCACCTGGAGGG - Intronic
1015756329 6:136610185-136610207 CTTCATGAGAATTAGCATGATGG + Intronic
1017340043 6:153310516-153310538 ATTCATAGGAATAAGGGGGAGGG - Intergenic
1020808283 7:12818584-12818606 ATTCATAAGAACAATCTGGAAGG + Intergenic
1021123391 7:16822435-16822457 CTTGATAAGGATCAGCAAGATGG + Intronic
1021822636 7:24513425-24513447 ATACATCAGAATCACCTGGAGGG + Intergenic
1021889188 7:25171060-25171082 ATGCACAAGAATCACCTGGAGGG - Intronic
1025293575 7:57755051-57755073 ATTCTTTTGATTCAGCAGGATGG - Intergenic
1027729434 7:81851366-81851388 ATTCATCAGAATCACCTGGAGGG - Intergenic
1027848431 7:83416593-83416615 ATTCATAAGAATCATAAAAAGGG - Intronic
1028512439 7:91640356-91640378 ATGCTTCAGAATCATCAGGAGGG + Intergenic
1030007729 7:105135134-105135156 ATCAAGAAGAATCAGCAAGAAGG + Intronic
1030663535 7:112248993-112249015 ACACAAAAGAATCAACAGGATGG - Intronic
1030692149 7:112547012-112547034 ATTCTTCAGAGTCAGCAGGCAGG + Intergenic
1031469761 7:122155250-122155272 GTGCATCAGAATCACCAGGAGGG + Intergenic
1031518746 7:122736480-122736502 AATCAGAAGAAACAGCAGAATGG + Intronic
1031850249 7:126854426-126854448 ATGCATCAGAATCACCTGGAAGG + Intronic
1032656791 7:133939100-133939122 AAGCAAAAGAAACAGCAGGAAGG + Intronic
1032689515 7:134269137-134269159 ATTCCAAACAATCAGGAGGAGGG + Intergenic
1034123782 7:148652735-148652757 ATTTATAAAAATCAGCGAGAGGG - Intergenic
1034182763 7:149151009-149151031 ATGAATAAGAATCAGCTGGAGGG - Intronic
1036438546 8:8758960-8758982 ATGCATCAGAATCATCTGGAGGG - Intergenic
1037147231 8:15586940-15586962 ATTCATCAGAATCACTAGGATGG - Intronic
1038166972 8:25094907-25094929 ATTTCTAAGACTGAGCAGGATGG - Intergenic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1040029586 8:42812666-42812688 ATTTGTAAGAATCAGGAGGCTGG + Intergenic
1040127389 8:43753522-43753544 ATTCATTTGATTCAGCAGGTTGG + Intergenic
1040327184 8:46354824-46354846 ATTCATTTGATTCAGCAGGTTGG - Intergenic
1040494271 8:47952120-47952142 ATCCAAAAGAATCAACAGCAGGG + Intronic
1040731753 8:50456224-50456246 TTTGATAAGAATCAGCAGTCAGG - Intronic
1043119064 8:76299727-76299749 ATTCAGACGAAACTGCAGGAAGG - Intergenic
1045110931 8:98939322-98939344 ATGCATCAGAATCACCTGGAGGG + Intronic
1046083803 8:109406339-109406361 ATTCAGAAGCATCAGCAGGTAGG - Exonic
1046478436 8:114780803-114780825 GTTCATAAAAAACAGCAGCAAGG + Intergenic
1046722104 8:117632000-117632022 ATTCATCAGAATCATCCTGAGGG - Intergenic
1047940997 8:129827143-129827165 CTGCATCAGAATCACCAGGAGGG - Intergenic
1048578600 8:135712314-135712336 ATCCATCAAAATCAGCAGGCTGG + Intergenic
1049946059 9:597148-597170 ATTCATAAGAATTAAAAGGTGGG - Intronic
1050062840 9:1728562-1728584 ATTGATCAGAATCACCTGGAGGG + Intergenic
1050110522 9:2210889-2210911 CTGCATCAGAATCACCAGGAGGG + Intergenic
1050250551 9:3739515-3739537 ATTCATCAGAATCACCTGGAGGG - Intergenic
1051075414 9:13227912-13227934 ACTCATAAGAAAAAGCAGAAAGG + Intronic
1051999092 9:23254559-23254581 ATTTATAAGAAACAATAGGAAGG + Intergenic
1052691684 9:31823078-31823100 AATTATAAGAATCATCAGGAAGG - Intergenic
1054162914 9:61690464-61690486 ATTCTTTTGATTCAGCAGGATGG + Intergenic
1054706954 9:68472354-68472376 ATCCAAAAGAATAACCAGGAGGG - Intronic
1054779043 9:69149749-69149771 CTTCATAAGAATTTGCAGAAGGG + Intronic
1055311509 9:74986762-74986784 ATTAAGAAGAATGAGCAGTAGGG - Intronic
1055699625 9:78928944-78928966 GTACATCAGAATCAGCTGGAAGG + Intergenic
1056769683 9:89467824-89467846 ATTTATAAGAATCATGAGGCTGG - Intronic
1057364209 9:94403655-94403677 ATTCAAAAGAAACAACAGCAGGG - Intronic
1057659127 9:96984416-96984438 ATTCAAAAGAAACAACAGCAGGG + Intronic
1058079240 9:100685018-100685040 ATTCCTATTACTCAGCAGGAAGG - Intergenic
1058741037 9:107942539-107942561 AATCAAAAGAATCAGAAAGATGG - Intergenic
1059474320 9:114532062-114532084 ATTCATATGAATCTGGAGGCTGG - Intergenic
1060330299 9:122662182-122662204 AGTCAGAAGAATGTGCAGGAGGG - Exonic
1186979964 X:14948218-14948240 ATGCATCAGAATCACCTGGATGG + Intergenic
1187420531 X:19130001-19130023 CTGCATCAGAATCACCAGGAAGG + Intergenic
1188354322 X:29172601-29172623 ATGCATTAGAATCACCTGGAGGG - Intronic
1188560355 X:31461424-31461446 ATACATCAGAATCACCTGGAGGG - Intronic
1189186371 X:39058950-39058972 ATGCATCAGAATCACCTGGAAGG - Intergenic
1189563713 X:42217621-42217643 ATGCATCAGAATCACCTGGAGGG + Intergenic
1189925467 X:45948889-45948911 GTTCATCAGAATCACCTGGAGGG + Intergenic
1190524909 X:51319252-51319274 ATTCTAAACAATGAGCAGGATGG + Intergenic
1190545323 X:51519641-51519663 ATTCTAAACAATGAGCAGGATGG - Intergenic
1190843848 X:54172689-54172711 ATGTATCAGAATCAGCTGGAGGG + Intronic
1191575706 X:62702839-62702861 TTTCATTTGAATCAGCAGGTTGG - Intergenic
1191668911 X:63731024-63731046 TTTAATAAGAAGCAGCAGAAGGG + Intronic
1192134057 X:68580591-68580613 GTTCATAAGATTTAGCAAGATGG - Intergenic
1192232615 X:69276459-69276481 ATGCATCAGAATCATCAAGAAGG + Intergenic
1193150974 X:78124375-78124397 ATGCATGAGAATCACCAGGAGGG - Intronic
1195400624 X:104457752-104457774 ATGCATCAGAATCACCAGGATGG + Intergenic
1196022304 X:111003020-111003042 ATACATTAGAATCATCAAGAGGG - Intronic
1197114268 X:122813985-122814007 ATTCATGAGAAACAGGTGGACGG - Intergenic
1198622795 X:138533204-138533226 AGTCATAAAGATCAGCAAGAAGG + Intergenic
1198848452 X:140939183-140939205 TTTCAAAAAATTCAGCAGGAGGG - Intergenic
1198982285 X:142412509-142412531 ATTCCAAAAAATCAGGAGGAGGG + Intergenic
1200910507 Y:8527546-8527568 ATCCAAAAGAATCAGAAGGATGG + Intergenic
1202336663 Y:23818940-23818962 ATTAGTCAGAATCAGCAGGGAGG + Intergenic
1202534102 Y:25851131-25851153 ATTAGTCAGAATCAGCAGGGAGG - Intergenic