ID: 1001752973

View in Genome Browser
Species Human (GRCh38)
Location 5:174145583-174145605
Sequence GTGGACTAGGGAACTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 7, 3: 19, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001752973 Original CRISPR GTGGACTAGGGAACTGAGCA AGG Intronic
900814064 1:4829807-4829829 ATGTTCTAGGGAACTGAGCTGGG + Intergenic
901107125 1:6765173-6765195 GTGGAGAAAGGAAGTGAGCAGGG - Intergenic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
903070405 1:20724343-20724365 GTGGACAAGGGAACTGGGTATGG - Intronic
903511600 1:23879894-23879916 GTGGACTAGGGAGCTATGCAGGG - Intronic
904955008 1:34275780-34275802 GCTGACTGGGGAACTAAGCAGGG - Intergenic
905102990 1:35541788-35541810 GTGAACTAGGGCAGAGAGCAAGG + Intronic
905387386 1:37614081-37614103 GTGGGCTGGGGCACTGTGCAGGG - Intronic
906300453 1:44677873-44677895 GTGGAATAAGGAACTGAGTTGGG + Intronic
907767170 1:57423440-57423462 GAGGAGTAGGGAAGTGAGAACGG + Intronic
913335250 1:117703753-117703775 GTGGAGTGGGGAACAGAGCAGGG - Intergenic
914449994 1:147782827-147782849 GTGGACAAGGGAAGTGAGACTGG + Intergenic
915014452 1:152720002-152720024 GTGGAACAGGGAGCAGAGCATGG - Exonic
915052815 1:153094129-153094151 GTTGACTTGGGCACAGAGCAAGG + Intronic
915475324 1:156149769-156149791 GTGGGCAAGGGAGCTGAGCAGGG + Intronic
916635581 1:166664540-166664562 GTGAACTAGGGTACAGAGGAAGG + Intergenic
922308705 1:224367724-224367746 TTGGTCTATGGAACTGATCATGG - Intronic
922674120 1:227540710-227540732 GTGGCAGAGGGAACTGAGCTGGG - Intergenic
923714521 1:236413505-236413527 GTGGAGTTGGGAGCTGAGCAGGG + Intronic
1063635014 10:7774052-7774074 GTGCAGGAAGGAACTGAGCATGG - Intronic
1064290362 10:14028495-14028517 GTGGACAAGGGATCAGAGCATGG - Intronic
1064497615 10:15930004-15930026 GTGGGATAGGGATTTGAGCATGG + Intergenic
1064966519 10:21020307-21020329 GTGGAAGAGGGACCTGAGCTTGG + Intronic
1067426748 10:46216588-46216610 GTGTACCTGGGGACTGAGCATGG + Intergenic
1067964146 10:50889792-50889814 GAGGATATGGGAACTGAGCAGGG + Intergenic
1070341129 10:75499356-75499378 GTGGACTAGTGAAGAGAGGATGG + Intronic
1072546744 10:96445862-96445884 ATGGACTAGGGAAGGGAGAATGG + Intronic
1074036110 10:109740454-109740476 GTGGAGGAGAGAACTCAGCATGG + Intergenic
1077538564 11:3135839-3135861 GTGGCCCAGGAAACTCAGCAGGG - Intronic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1078346741 11:10556477-10556499 GTGGAGTAGGGAAAGGAGCATGG + Intergenic
1079901987 11:26198130-26198152 GAGGACTAGGGGATTGAGGATGG + Intergenic
1081701411 11:45155113-45155135 TTTGACTAGGGCACTGAGCTGGG + Intronic
1083671172 11:64300574-64300596 GCGGGCTGGGGAACTGAGCCGGG - Exonic
1084085129 11:66851486-66851508 GTGGAAGAGGGTACTGAGCAAGG + Intronic
1084278103 11:68066734-68066756 GAGGACTAGGGCTGTGAGCAGGG - Intronic
1084570976 11:69959685-69959707 GGGTTCTAGGGAAGTGAGCAAGG + Intergenic
1087671724 11:101114771-101114793 GTGCACTAAGGACCTGAGCCAGG - Intronic
1087899359 11:103623151-103623173 CTGGACTAGGGAAATGGGCAAGG + Intergenic
1088223972 11:107598821-107598843 GTGGGCTAGAGAACTGGGTATGG - Intronic
1089324002 11:117644823-117644845 GTGGTCAAGGGATCTCAGCAGGG + Intronic
1092230336 12:6772584-6772606 GTGTCCCAGGGAACAGAGCAGGG - Exonic
1100575961 12:95891809-95891831 GAGACCTAGGGAACTCAGCAGGG + Intronic
1100644064 12:96510510-96510532 GGGAACTGGGGAACTGAGGAAGG - Intronic
1101612412 12:106303319-106303341 CTGGAGTAGGGAACTGAGCCAGG + Intronic
1102615389 12:114149629-114149651 GTGGAGTAGGGGTCTGAGCGTGG - Intergenic
1103307313 12:119975500-119975522 GTGGGACAGGGAACTGAACAGGG - Intergenic
1103607682 12:122099209-122099231 CTGGCCTAGGCAACAGAGCAAGG + Intronic
1104793189 12:131496932-131496954 GTGGAGCAGAGAACTGAGAAAGG + Intergenic
1107521006 13:41181382-41181404 GTTGACTAGGGAGATGAGGAGGG + Intergenic
1110782411 13:79481420-79481442 GTGGCCGTGGGAGCTGAGCACGG + Exonic
1112538885 13:100286489-100286511 GTGGAGTAGGTAACTGAAAAAGG + Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113783963 13:112992567-112992589 GTGGATTAGGGAAATAAGCGTGG + Intronic
1116204953 14:41853380-41853402 TTGGTCTAGGGAACTGACAATGG + Intronic
1118390678 14:65292956-65292978 GTGGGTTAGGGAACTGAGAAGGG - Intergenic
1119311681 14:73652156-73652178 GGGGGCTGGGGAACTGGGCAGGG - Intronic
1119724890 14:76916081-76916103 ATGCACTATGGAACTGGGCAGGG - Intergenic
1119949983 14:78735083-78735105 TTGGACTAGGGCATTGACCAGGG + Intronic
1122206733 14:100151393-100151415 GTGCACGAGGCAGCTGAGCATGG + Intronic
1124170508 15:27368393-27368415 GAGGAATATGGAACTGGGCATGG + Intronic
1124925374 15:34065384-34065406 GTGAACTGGGGATCTGAACAAGG - Exonic
1126217433 15:46172399-46172421 GTGGCCTAGAGGACTGAGGAAGG + Intergenic
1126343598 15:47669966-47669988 GTGCTCTGGGGAACTGAACAAGG - Intronic
1126878268 15:53067330-53067352 GTGGAGGAGGGAAGGGAGCATGG - Intergenic
1129750040 15:78056350-78056372 ATGGAATGGGGAACTTAGCAGGG + Intronic
1129973699 15:79803364-79803386 GCAGCCTAGGGAACTGAGCATGG - Intergenic
1130096868 15:80862554-80862576 GTGGAACATGTAACTGAGCATGG + Intronic
1130884341 15:88080982-88081004 AAGGACAGGGGAACTGAGCATGG - Intronic
1132974853 16:2706140-2706162 GTGGTCCAGGGCACTGAGCCTGG + Intronic
1133049237 16:3107335-3107357 GAAAACAAGGGAACTGAGCAAGG - Intergenic
1138650659 16:58459124-58459146 GAGGCCTAGGGGACTCAGCAAGG - Intergenic
1139244806 16:65431362-65431384 GCTGACTTGGGAACTGGGCAGGG - Intergenic
1140754171 16:78052751-78052773 GAGAAAGAGGGAACTGAGCAAGG - Intronic
1146076931 17:29739275-29739297 GTGGACTTGTGACCTGTGCAGGG + Intronic
1149163727 17:53725484-53725506 GCTGGCTAGGGAACTGAGCCTGG - Intergenic
1150717105 17:67581425-67581447 GTGGACTCTGGAACTGCCCAGGG + Intronic
1152417177 17:80170220-80170242 GTGGACTAGAGAACAGAAAACGG + Intronic
1153451376 18:5233286-5233308 ATGGACCAGGCAACTGAGGATGG + Intergenic
1154482055 18:14840038-14840060 ATTGACTAGGTTACTGAGCAAGG - Intronic
1155006280 18:21732424-21732446 CTGGACTGGGCAACAGAGCAAGG - Intronic
1155547280 18:26928595-26928617 GGAGAGTAGGGAACTGAGAAAGG + Intronic
1156148989 18:34222317-34222339 GTGGAAGAGGGAAGTGAGGAAGG + Intronic
1158179971 18:54703316-54703338 GTGCAGTAGGGAACTGAGATAGG + Intergenic
1158458056 18:57624622-57624644 GTGGAATAGGTATCTGGGCACGG + Intergenic
1159712181 18:71774487-71774509 GTGGATTAGGGAAGTGATGATGG - Intronic
1159750302 18:72292800-72292822 GGGGACTAGGGAATTGCACAAGG - Intergenic
1160354700 18:78216887-78216909 GTGGTCACTGGAACTGAGCATGG - Intergenic
1162489146 19:10981595-10981617 GAGGACCAGGAAACTCAGCAGGG - Intronic
1162618646 19:11822025-11822047 GGGGTCTAGGGAATTGACCAAGG + Intronic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1165394686 19:35557900-35557922 GTGGACGAGGGAACGGGGCGGGG + Intronic
1166074443 19:40405495-40405517 AGGGACTAGGGGGCTGAGCAGGG + Intronic
1166643425 19:44513277-44513299 GAGGACTGGGGACCTGGGCAAGG + Exonic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168289091 19:55348262-55348284 ATGGACTAGGGGACTGAGGCTGG + Intergenic
927520332 2:23694515-23694537 GTCGACGAGGCAACTGAGGAGGG - Intronic
928301944 2:30132976-30132998 GTGGACTAGGAGAATGAGCATGG + Intergenic
934962462 2:98688808-98688830 GTGGGCTAGGAAACTGGGCATGG - Intronic
939614695 2:144349140-144349162 GGGGAGTGGGGAACTGAGAAGGG + Intergenic
942198601 2:173548126-173548148 GTGTAATAGGGACCTGGGCAAGG + Intergenic
944109806 2:196120189-196120211 ATGCACTAGGGAACTGGGCAAGG + Intergenic
944511762 2:200472410-200472432 TTGGTCCAGGGAACTGATCAGGG + Intronic
1168869183 20:1114312-1114334 GTGGAGTAGGGAAGTGAGACAGG - Intronic
1176798549 21:13396580-13396602 ATTGACTAGGTTACTGAGCAAGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177562116 21:22769699-22769721 GTCGACTAGGGAAATGGACAAGG + Intergenic
1177744038 21:25188873-25188895 GTGATCTAGGGAGATGAGCAGGG - Intergenic
1179874495 21:44261310-44261332 GTGCATCAGGGATCTGAGCAGGG - Intronic
1181482282 22:23207891-23207913 GGGGTGTAGGGCACTGAGCAGGG - Intronic
1182093704 22:27612529-27612551 GTGAAATAGGGAACTGAGGCTGG - Intergenic
1183028118 22:35081608-35081630 GTGGGGAAGGGAACTGGGCAGGG + Intronic
949127454 3:463539-463561 GTGTACTAGCCAACTGAGCTCGG + Intergenic
953158381 3:40395482-40395504 AGGGACTAGGGAACTGAGATGGG + Intronic
953534378 3:43766090-43766112 GTGGACTAGGGTGGGGAGCAGGG + Intergenic
953788933 3:45931562-45931584 GGGAACTAAGGAACTGAGGATGG + Intronic
954999537 3:54914418-54914440 GAGGACTGGGGATCTGAGAAGGG - Intronic
956706597 3:72004459-72004481 GTGCCCAAGGGACCTGAGCAGGG - Intergenic
959175506 3:102904525-102904547 GTGGAGTAGGTAACTGAAAAAGG + Intergenic
962439023 3:135394838-135394860 CTAGACTAGGGAAAAGAGCAAGG - Intergenic
968888678 4:3353719-3353741 GGGAACTAGGGAAATGACCATGG + Intronic
969660359 4:8523833-8523855 GTAGACAAGGAAACTGAGCTTGG + Intergenic
970417910 4:15877481-15877503 GTGGGCTGGGAATCTGAGCAGGG + Intergenic
970635883 4:18009397-18009419 GAGGAATAGGGACCTGAACAGGG - Intronic
971066809 4:23042353-23042375 GTGGAGTAGGTAACTGAAAAAGG - Intergenic
972600153 4:40565002-40565024 GTGAACGTGGGGACTGAGCAGGG + Intronic
973623263 4:52748064-52748086 GTGGACCAGGGAGCAGTGCAGGG + Intronic
976477240 4:85498296-85498318 GTGGACTAGGGAGCTGGGCCTGG + Intronic
977566947 4:98590234-98590256 GTGAAATAGGGACCTGAGCCAGG + Intronic
982317933 4:154050058-154050080 ATGGGATAGGGAACTGAGCTGGG - Intergenic
985092326 4:186377072-186377094 GTGGTCTGTGGAACTGAGCCAGG - Intergenic
987138608 5:14922450-14922472 GTAGACTAGGGAACAGAGAGTGG + Intergenic
993280808 5:85921898-85921920 GAGGACTAGGGATCTATGCATGG - Intergenic
994320260 5:98386834-98386856 GTGGAATAGGGCACCAAGCAGGG - Intergenic
997411497 5:133694481-133694503 GTGGACTGTGAAACTCAGCATGG + Intergenic
1001752973 5:174145583-174145605 GTGGACTAGGGAACTGAGCAAGG + Intronic
1002312514 5:178323343-178323365 GGGGACTGGGGATCAGAGCAGGG - Intronic
1005972336 6:30771111-30771133 GTGGAGAAGGCATCTGAGCAGGG - Intergenic
1006670781 6:35728593-35728615 GTGGAGTAGGGAGCCGAGGAAGG + Intergenic
1010390778 6:75334726-75334748 GTGGAGTAGGGGGCTGAGCAAGG - Intronic
1012398733 6:98827697-98827719 GAGGACCTGGGCACTGAGCAAGG - Intergenic
1018104937 6:160476588-160476610 ATGGTCTAGGGAAATGTGCAAGG - Intergenic
1018105030 6:160477673-160477695 ATGGTCTAGGGAAATGTGCAAGG - Intergenic
1018115267 6:160577678-160577700 ATGGTCTAGGGAAATGCGCAAGG - Intronic
1018122603 6:160650889-160650911 GTGGTCTAGGGAATTGTGCAAGG - Intronic
1018272006 6:162089874-162089896 GGGGAAGAGGGAAGTGAGCAGGG + Intronic
1019615580 7:1958242-1958264 GTGGAGAAGGGAACTCACCATGG - Intronic
1019715663 7:2538192-2538214 CAGGTCTAGGGACCTGAGCATGG + Exonic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1020437181 7:8176929-8176951 GTGGTTTAGTGAAATGAGCAGGG - Intronic
1026896920 7:74014600-74014622 CTGAACCAGGGATCTGAGCAGGG + Intergenic
1032435193 7:131895111-131895133 GTGGCCTAGGGCAGTGATCAGGG + Intergenic
1034763243 7:153693550-153693572 GTGGGCGTGGGAAATGAGCATGG + Intergenic
1035768474 8:2127407-2127429 GAGGTCTAGGGAACTGTGCGGGG - Intronic
1038053739 8:23838040-23838062 GTAGAAAAGGAAACTGAGCAGGG + Intergenic
1038619819 8:29131175-29131197 GGGGAGCAGGGAAGTGAGCAAGG + Intronic
1039334059 8:36570643-36570665 GTGGTCTAAGGGTCTGAGCAGGG + Intergenic
1046811785 8:118540918-118540940 GTGGACATGTGACCTGAGCAGGG + Intronic
1047350421 8:124068318-124068340 GTGGTCTGAGGAACTGAGCCTGG - Intronic
1048242924 8:132762020-132762042 GTGGGCCAGGGAGCTGGGCAGGG - Intergenic
1048590297 8:135815137-135815159 GTGGTTTAGGGAAATGAGAAGGG + Intergenic
1049697031 8:143989252-143989274 GAGGACTTGGGAGCTAAGCAGGG + Intronic
1050007813 9:1152336-1152358 GTGGGCTAGGGATGTGGGCAAGG - Intergenic
1056683082 9:88737068-88737090 GTGGATCAGGAATCTGAGCAAGG + Intergenic
1058814720 9:108672540-108672562 GTGGAGCAGGGAACTGGGCTGGG - Intergenic
1058868942 9:109186072-109186094 GTGCAGGAGGGCACTGAGCATGG - Intronic
1059502311 9:114765790-114765812 GAGGAGTAGGGAGATGAGCAGGG - Intergenic
1059647341 9:116280426-116280448 ATGGAACAGGTAACTGAGCAAGG + Intronic
1060745649 9:126129183-126129205 GTGGGGTAGAGAACTGGGCAGGG - Intergenic
1061162509 9:128903282-128903304 GTGGAATGGGGCACTCAGCAAGG - Intronic
1062721299 9:138045651-138045673 GTGGACTTAGGATCTGAGCTGGG + Intronic
1203761551 EBV:14966-14988 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203762480 EBV:18038-18060 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203763409 EBV:21110-21132 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203764338 EBV:24182-24204 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203765267 EBV:27254-27276 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203766196 EBV:30326-30348 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203767125 EBV:33398-33420 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1188987759 X:36783020-36783042 GTGCACTAGTGAACAGGGCAGGG + Intergenic
1195399441 X:104446102-104446124 GAGGACTTGGGAAGTGAGCTTGG + Intergenic
1196868442 X:120090189-120090211 GTTGACCAGAGAAGTGAGCAAGG + Intergenic
1196889979 X:120282454-120282476 TTGGACTAGGCAACTGAGAGGGG - Intronic
1197353486 X:125405083-125405105 GTGAACTAAGGAACTGTGAAAGG + Intergenic
1199476283 X:148249107-148249129 GTGGATTAAGGTAGTGAGCAGGG - Intergenic
1200040344 X:153361143-153361165 GTGCACAAGAGATCTGAGCAAGG - Intergenic