ID: 1001756775

View in Genome Browser
Species Human (GRCh38)
Location 5:174176404-174176426
Sequence CCTTTCAGCCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001756775 Original CRISPR CCTTTCAGCCAGAAACTGGA AGG (reversed) Intronic
901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG + Intronic
905349238 1:37333185-37333207 CCCTTCAGCCAGAGGCAGGATGG - Intergenic
905370329 1:37479593-37479615 CCTTTCAGTCTGAAAGTGAAAGG - Intronic
908624026 1:66019721-66019743 CCTTGCAGCCAGAAACAGAAAGG + Intronic
915827235 1:159091003-159091025 CATTTCAGCAAGAGACTGAAAGG - Intronic
916828672 1:168468576-168468598 TCTTTCAGGCAGAAAGAGGAGGG + Intergenic
918563742 1:185900985-185901007 ACTTTCAGACAGAAGTTGGATGG - Intronic
921543967 1:216452369-216452391 ATTTGCAGCCAGAAACTAGAAGG - Intergenic
922070573 1:222188699-222188721 ACTGTCTGCCAGATACTGGATGG - Intergenic
922635839 1:227170073-227170095 CCCTTCAGCTTGAACCTGGATGG + Intronic
1066143190 10:32528199-32528221 CCATTCAGCCATAAAAAGGATGG - Intronic
1066310492 10:34191387-34191409 CCTCTCAGCCAGTGACTGGTTGG - Intronic
1068307771 10:55235939-55235961 CATTCCAGTCAGAAAATGGAAGG - Intronic
1071398086 10:85242779-85242801 CCTGTCATGCAGAAACTTGATGG + Intergenic
1071482869 10:86078315-86078337 CATTTTAGCAGGAAACTGGAAGG - Intronic
1072793066 10:98332834-98332856 CCATGCAGCTAGAAAGTGGAGGG + Intergenic
1075276204 10:121094914-121094936 TCTTGCAGCCACAAACTTGATGG + Intergenic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1078542211 11:12221738-12221760 CCTTTCAGCCAGCAGCTCCAGGG - Exonic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079515837 11:21267824-21267846 ACTTTAAGTCAGAAACTGGTAGG - Intronic
1080644882 11:34181353-34181375 GCTTTGAGCTGGAAACTGGAGGG - Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1084627222 11:70317734-70317756 CCATCCATCCAGAAACAGGAAGG - Intronic
1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG + Intronic
1085891356 11:80583901-80583923 CTTTTCAAACATAAACTGGAAGG + Intergenic
1086770049 11:90750941-90750963 CCTTTCTGCCAGAACTTGGTAGG - Intergenic
1087541414 11:99526090-99526112 CCTTTAAGCAAAAAACTGTAAGG + Intronic
1092225955 12:6748533-6748555 CCTCTCAGCCTGTACCTGGAGGG + Exonic
1093401378 12:18751042-18751064 CCTTTGTGCCAGAAACTCCAGGG - Intergenic
1099594950 12:84649485-84649507 CCTTTCAGCCAAAAACTGCCAGG - Intergenic
1100317712 12:93460821-93460843 CCTGACAGCCAAAAACTGGCTGG - Intergenic
1101560999 12:105857990-105858012 TTTTTCAGCATGAAACTGGAAGG - Intergenic
1102519979 12:113472094-113472116 CCCGTCAGCCCCAAACTGGAAGG - Intronic
1104368773 12:128203427-128203449 CCTTCCAGCCTGAAGCTTGAAGG + Intergenic
1104504954 12:129323046-129323068 CCTGTCAGCAACAAACTGGAAGG - Intronic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1108692412 13:52871224-52871246 GACTTCAGCTAGAAACTGGAGGG + Intergenic
1111316890 13:86575043-86575065 TCATTCAGCCTGAAAATGGAAGG - Intergenic
1112801219 13:103111575-103111597 CAATTCATCCAGAACCTGGAAGG - Intergenic
1113170636 13:107498808-107498830 CCTTTCAGCCTCTAACTCGATGG - Intronic
1115372894 14:32638450-32638472 CATTTCAGCCAGATATTTGAGGG + Intronic
1117544787 14:56783830-56783852 CATATCAGCCATTAACTGGAGGG + Intergenic
1121015319 14:90545554-90545576 TCTGTCCGCCAGAAAGTGGATGG + Intronic
1121699996 14:95945438-95945460 CCCTTCAGAAAGACACTGGAGGG - Intergenic
1122660790 14:103293639-103293661 CCTGGCAGCCAGACACAGGATGG - Intergenic
1126302715 15:47217420-47217442 CCTTTCAACAGGAAACTGTAGGG + Intronic
1127275394 15:57439006-57439028 CCTTCCTGCCAGGAACTGGACGG + Exonic
1128757885 15:70195762-70195784 CCTTTCCCCCTGAGACTGGAGGG - Intergenic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1137792217 16:51184863-51184885 CTTCTCAGCCATAAACAGGAAGG - Intergenic
1138252433 16:55512365-55512387 CAAATCAGACAGAAACTGGAGGG + Intronic
1144103180 17:11962044-11962066 CCTGTCAGCCACACAGTGGAGGG - Exonic
1148325485 17:46780931-46780953 CTATTCAGCCAGAAAAAGGAAGG + Intronic
1151999517 17:77636722-77636744 GCTTCAAGCCAGAAACTGGAAGG - Intergenic
1155331701 18:24725506-24725528 AGTTTCATCCAGAAACTGGAAGG - Intergenic
1155433273 18:25784322-25784344 GCTTGAAACCAGAAACTGGAGGG + Intergenic
1155769144 18:29674460-29674482 CTTTTCAGCAAGCAAATGGAAGG + Intergenic
1157270722 18:46273975-46273997 CCTCTCAGCCAGGAACTGTGTGG + Intergenic
1161901446 19:7122644-7122666 CCTGGCAGCGAGAAACTGCATGG - Exonic
1162885303 19:13692648-13692670 CCCTTCAGCATGCAACTGGATGG - Intergenic
1163241280 19:16065375-16065397 ACTTTGAGCCATAAGCTGGAGGG - Intergenic
1163280185 19:16311549-16311571 CCTTTTAAGCAGAAACTTGAAGG - Intergenic
1163782343 19:19257173-19257195 CCTGTTACCCAGAAACTGCAGGG + Exonic
1167699660 19:51035047-51035069 CCCTTAACCCGGAAACTGGATGG - Intronic
926149110 2:10414938-10414960 TCTTGCAGCCAGCATCTGGAGGG - Intronic
928180350 2:29064415-29064437 ACCTTCAGCCAGACACTTGAGGG + Exonic
930113487 2:47698716-47698738 TCTTCCAGCCAGAGACTGCATGG - Intronic
930188671 2:48435885-48435907 CCTTTCAGACAGGACCCGGATGG + Intergenic
932460028 2:71876078-71876100 CCTCCCAGCCAGAACCTGCAGGG + Intergenic
936389961 2:112062933-112062955 CCCTTCAGCCAGAAACTCCAGGG + Intronic
936625252 2:114141577-114141599 CCTTACAACAGGAAACTGGAAGG + Intergenic
938724064 2:134091354-134091376 CCTCTCAGTCAGAAACTCCAAGG - Intergenic
938791344 2:134679118-134679140 CCTATCAGCCAGCAGCTGAAAGG - Intronic
939891382 2:147740960-147740982 CTATTCAGCCTGAAAATGGAAGG - Intergenic
940594293 2:155769741-155769763 CATCTGAGCCATAAACTGGAAGG - Intergenic
945923763 2:215782753-215782775 CCTCTCAGCCATTAACTGGGTGG + Intergenic
946039689 2:216773106-216773128 CCTATCAGCGAGAAACTAGATGG - Intergenic
947346931 2:229201457-229201479 CCCTTCAGCCTTAAACAGGAAGG - Intronic
947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG + Intronic
948004630 2:234597135-234597157 CCTTTCAGTCAGATCCGGGAAGG - Intergenic
1171333903 20:24365907-24365929 CCTGTAAGCTAGAACCTGGAAGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173204466 20:40981885-40981907 CCTTTCAGCCAGAAACCAGGAGG - Intergenic
1174281172 20:49440631-49440653 CCTTTCAACAACAAACTAGATGG + Intronic
1175221892 20:57421953-57421975 ACTTTGTGCCAGACACTGGACGG - Intergenic
1178578240 21:33814377-33814399 CCTGTCAGACAGAAACTGCTGGG + Intronic
1178920447 21:36735148-36735170 CCTGTCAGTCAGTAGCTGGAGGG + Intronic
1180630082 22:17222775-17222797 CCTGGCAGCAAGAAAATGGAAGG + Intergenic
1183032056 22:35113777-35113799 CCCTTCAGCCAGAACATGGGTGG - Intergenic
1183726765 22:39594290-39594312 ACTTTGAGCCTGAAACTGGCAGG + Intronic
1184429969 22:44436925-44436947 TCATTCATCCAGAAACAGGAAGG - Intergenic
1185100477 22:48838310-48838332 ACTTTCAGCCAGACACTAGGAGG - Intronic
952052827 3:29406472-29406494 CCTTTCAGCCAGACATAGAAAGG - Intronic
954233035 3:49233453-49233475 CCTTAATGCCAGGAACTGGAGGG + Intronic
954283140 3:49598984-49599006 ACATTCAGCCAGAAACTAGCAGG + Intronic
954621949 3:52001530-52001552 CATTTCCAGCAGAAACTGGAAGG + Intergenic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
961377826 3:126478548-126478570 CCTGCCATCCAGAAACTGGCCGG + Intergenic
964477665 3:157111104-157111126 CCTGTCAGCAAGAAACTAGTAGG + Intergenic
966821824 3:183930830-183930852 AGTTTAAGCCACAAACTGGATGG - Intronic
969464205 4:7345017-7345039 CCTTCCAGCCAGCAGCAGGAGGG - Intronic
973237661 4:47922852-47922874 CCTTTGAGCCAGGCACAGGAGGG + Intronic
974118007 4:57604379-57604401 AGTTTAGGCCAGAAACTGGAAGG + Intergenic
975377536 4:73663255-73663277 CTTTTGACCCAGAGACTGGAGGG + Intergenic
976922398 4:90456002-90456024 AATTGCAGCCAGAAACTGGTGGG + Intronic
977370133 4:96124876-96124898 TCTTTCAGCCACTAACTGGTAGG + Intergenic
977858212 4:101922076-101922098 CCTGTCAGTCAGATACTGGAGGG - Intronic
978010482 4:103676161-103676183 CCTGTGAGCCAGAAGCTGCAAGG - Intronic
981645741 4:146996725-146996747 CCTTACAGAAAGAAACTGGGTGG - Intergenic
987132019 5:14869245-14869267 CTTTTCAGCATTAAACTGGAGGG - Intronic
988919370 5:35926320-35926342 CCTTGCTGCCAGCCACTGGAGGG - Intronic
990923956 5:60997546-60997568 CCTTTGATTCATAAACTGGAAGG + Intronic
991577117 5:68116053-68116075 CCTGTAACCCAGAAACTGCAGGG + Intergenic
995238736 5:109860897-109860919 TTTTTCAGCCATAAATTGGAGGG + Intronic
996164344 5:120206618-120206640 ACTTTCACCCAGAAAGTGGCAGG - Intergenic
997381863 5:133444113-133444135 GCTTTGAGCCAGACACTGTAAGG - Intronic
998417890 5:141958794-141958816 CCTTTCAGCAGGAAACTGTGAGG + Exonic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001756775 5:174176404-174176426 CCTTTCAGCCAGAAACTGGAAGG - Intronic
1004505996 6:16247094-16247116 CCCTTCAATCAGAAAGTGGACGG + Intronic
1006174669 6:32114795-32114817 CCTCTAAGCCCTAAACTGGAGGG - Intronic
1011004131 6:82624813-82624835 CTTCCCAGCCAGTAACTGGAAGG + Intergenic
1012181750 6:96163189-96163211 TCTTTGAGCCAGAAACTGGTAGG - Intronic
1013420979 6:109966607-109966629 CCAGCCAGCCAGAAACAGGAAGG + Intergenic
1015369203 6:132431618-132431640 CCATTCAGCCATAAAAAGGATGG - Intergenic
1015989112 6:138917124-138917146 CCTTTCAGGCACAAACAAGAAGG - Intronic
1018932039 6:168246845-168246867 ACTTTCAGCCAGAAACATGGAGG + Intergenic
1020879660 7:13743677-13743699 CCTTTCAGGCAGAAAAAGCATGG + Intergenic
1020962375 7:14821488-14821510 CATTTCAGCCGAAAACTGAAAGG + Intronic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1023627095 7:42126884-42126906 CCTGTAATCCAGAAACAGGAAGG - Intronic
1024631380 7:51250229-51250251 CCTTGCAGCCAGAAAGTGACTGG + Intronic
1025972627 7:66342259-66342281 CCATTCTCCCAAAAACTGGAGGG + Intronic
1029731189 7:102439268-102439290 CCTGGCTGCCAGAGACTGGAGGG - Intronic
1030710476 7:112742992-112743014 TTTTTCATCCAGAAATTGGAAGG - Intergenic
1031490431 7:122381143-122381165 GCTTTCAGCCAGGAGCTGGGGGG - Intronic
1031712384 7:125065244-125065266 CATTTTAGCAAGAAGCTGGATGG - Intergenic
1032200573 7:129819846-129819868 CCATTCAGGCAGGAAATGGAAGG - Intergenic
1034431176 7:151041895-151041917 TCTTTGCCCCAGAAACTGGAGGG - Intronic
1037318269 8:17619389-17619411 CATTTCAGAAAGAAACTGAAGGG + Intronic
1037663378 8:20945399-20945421 CCTCTCAGCCAGAAACACAAAGG - Intergenic
1039490306 8:37942476-37942498 CCCTTCAGGAAGAACCTGGAAGG - Intergenic
1040828610 8:51651801-51651823 AGTGTCATCCAGAAACTGGAAGG + Intronic
1041463512 8:58137090-58137112 CCTTTTAGCCAGAAACTGCATGG + Intronic
1046918385 8:119701306-119701328 CTATTCAGCCAGAGACAGGATGG + Intergenic
1047259600 8:123243679-123243701 ACTTTCAGGGAGAAACTGAAAGG - Intronic
1048290190 8:133175280-133175302 CCTATGTGCCAGACACTGGAAGG - Intergenic
1049042005 8:140119478-140119500 CTTTACAGCCAGAAACTTGCGGG - Intronic
1049229977 8:141476901-141476923 CCCTTCAGCTGGAAACTGCAGGG + Intergenic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1049779010 8:144419152-144419174 CGATTCAGCCAGAAAAAGGAAGG + Intergenic
1049982077 9:913558-913580 CAGTTCAGCTGGAAACTGGATGG + Intronic
1055583141 9:77729514-77729536 CATATCAGCCAAAAACTAGAGGG + Intronic
1057119895 9:92562043-92562065 CCTTTAAGACAAAAACTAGATGG + Intronic
1057617280 9:96602989-96603011 GCTTCCAGCCAGCTACTGGATGG + Intronic
1060119455 9:120974491-120974513 TCTTTCAGCCAGGATCAGGAGGG + Intronic
1060239877 9:121893805-121893827 ACATTCTGTCAGAAACTGGAGGG + Intronic
1060439203 9:123622864-123622886 CTTTTCTCCCAGAAACAGGAAGG + Intronic
1060677487 9:125528542-125528564 CTTTTCAGTTAGAAAATGGAAGG + Intronic
1191033241 X:55997754-55997776 CCCTTCATCCAGAATCTGCAAGG - Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1196560104 X:117136016-117136038 ACTATCTGCCAGAAACTGCATGG - Intergenic
1197630090 X:128848434-128848456 CCTTTGAGCAATAAACTGGAGGG + Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic