ID: 1001758113

View in Genome Browser
Species Human (GRCh38)
Location 5:174186283-174186305
Sequence AGGCTGCCCCGAGGACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001758110_1001758113 -1 Left 1001758110 5:174186261-174186283 CCAGGATCATTATTGAAGAAAGA 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1001758113 5:174186283-174186305 AGGCTGCCCCGAGGACCCCCCGG 0: 1
1: 0
2: 1
3: 26
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001758113 Original CRISPR AGGCTGCCCCGAGGACCCCC CGG Intronic
900523440 1:3117041-3117063 CAGCTGCCCCCAGGACCCACGGG + Intronic
900583179 1:3419256-3419278 AGGCTGTCCCCGGGACCCCGTGG - Intronic
900739001 1:4319145-4319167 GGGCTTCCCCGAGCTCCCCCAGG + Intergenic
901056014 1:6448925-6448947 CGGCTGCGCCGCGGACCCCAAGG + Exonic
901181080 1:7342278-7342300 AGGAAGCCCAGGGGACCCCCGGG - Intronic
901323156 1:8351457-8351479 AGGCTGGCCACAGGAGCCCCAGG - Intergenic
901492533 1:9603703-9603725 GGGCAGCCTCTAGGACCCCCAGG - Intronic
901529753 1:9845487-9845509 AGGCTGCCCCGAAGCTCCCTGGG - Intergenic
901825706 1:11859446-11859468 GGGCGCCCCCGAGGACCCGCAGG - Intergenic
901835226 1:11919800-11919822 AGGCTGGGCCGGGGCCCCCCAGG - Exonic
902089662 1:13893162-13893184 AGGCTGCCCCAGGGTCCCCGGGG - Intergenic
902389241 1:16093060-16093082 AGGAGGCCCAGAGGACCCCTAGG + Intergenic
902478340 1:16699570-16699592 CGGCTGCGCCGCGGACCCCAAGG - Intergenic
902815296 1:18913195-18913217 AAGCTGCCTCGAGCGCCCCCTGG + Intronic
903068985 1:20717411-20717433 AGGCCGCCCCGAGAGTCCCCAGG - Intronic
903182397 1:21611579-21611601 AACCTGCCCCGGGGCCCCCCAGG + Exonic
903693503 1:25191224-25191246 TGGCTGCCCCGTGGGCCCTCAGG + Intergenic
904575743 1:31504017-31504039 AGGCTGCCCTGATGAAACCCCGG - Intergenic
907553386 1:55323685-55323707 GGGCTGCCCAGTGGACCACCTGG + Intergenic
909203544 1:72725107-72725129 AGTCTGACCTGAGGACCCCTTGG + Intergenic
912455343 1:109793037-109793059 AGGCTGCCCTGGGGAACACCTGG - Intergenic
913322179 1:117596509-117596531 AGGCGGCCCCCAGGCCCCTCAGG - Intergenic
915049136 1:153049351-153049373 AGTCTGACCTGAGCACCCCCTGG + Intergenic
916203376 1:162292924-162292946 TGACTGTCCCTAGGACCCCCAGG + Intronic
922728977 1:227940282-227940304 AGGCTGCACGCAGGACCCCCCGG + Intronic
1062938707 10:1406412-1406434 AGCCTTCCACGAGGTCCCCCAGG - Intronic
1062971774 10:1654000-1654022 AGCCAGCCCCCAGGACCCCCGGG - Intronic
1064172878 10:13049741-13049763 AGGCTGCCCAGAAGAGCCCTGGG + Intronic
1065025274 10:21534740-21534762 AGGCTGGGCCGAGAACCCGCTGG + Exonic
1067037765 10:42932475-42932497 AGGCTACCCCGAGTGCCGCCAGG - Intergenic
1069878217 10:71576072-71576094 GGGCTGCCCAGAGGCCCCCTGGG - Intronic
1070983295 10:80667165-80667187 AGGCCTCCATGAGGACCCCCAGG - Intergenic
1072660311 10:97359930-97359952 AGGCTTCCCACAGGAGCCCCTGG + Intronic
1075871066 10:125773179-125773201 AGACAGCCCTGAGCACCCCCGGG + Intronic
1076165548 10:128279583-128279605 AGGCTGCCCAGGGAACCACCTGG - Intergenic
1076402714 10:130194271-130194293 GGGGTGCCTCGAGGACCCCTGGG - Intergenic
1076706092 10:132302432-132302454 CAGCTGCCCCAAGGGCCCCCAGG + Intronic
1076870245 10:133189414-133189436 AGGCAGCTCCGAGGACCCCGGGG + Intronic
1076903514 10:133351295-133351317 AGGTTGCTCCGAGGCCCACCTGG - Intronic
1076905199 10:133357846-133357868 AGGCTTGCACGGGGACCCCCGGG - Intronic
1077019165 11:409884-409906 AGCCTGCCCCGAGGAGGCCCCGG - Exonic
1077078111 11:710298-710320 AGGCTGCTCCGTGGACCTCTTGG - Intronic
1077155764 11:1090180-1090202 AGCCTCCCCCGAGGGCCGCCTGG - Intergenic
1077463592 11:2722975-2722997 AGCCTGCCCCGAGGCACCCCAGG - Intronic
1077517747 11:3012061-3012083 AGGCTGCCCCGTGCACCACAGGG - Intronic
1078391496 11:10938951-10938973 TGGCTGCCCAAAGGACCCCATGG + Intergenic
1078933301 11:15929748-15929770 AGGCTGCCCCGGGAAGCCCAAGG + Intergenic
1081710481 11:45212652-45212674 AGGCTGCCTGCAGGACCCCTCGG + Intronic
1082050539 11:47767212-47767234 GTGCTGCCCCGAGGACCCGGCGG + Exonic
1084128748 11:67118401-67118423 CCGCTGCACCGAGGAGCCCCCGG + Intergenic
1084517972 11:69646666-69646688 AGGCTGCCCCCAGGCTCCGCTGG + Intronic
1085267346 11:75244762-75244784 AGGGTGCCCCGCAGTCCCCCAGG + Intergenic
1087007841 11:93486597-93486619 AGGCTGCTCTGAAGGCCCCCAGG + Intronic
1102412918 12:112735845-112735867 AGGCTGCTCCATGGACCCACTGG + Intronic
1103563541 12:121804465-121804487 AGCCCGCCCAGGGGACCCCCGGG + Intronic
1104502448 12:129299227-129299249 AGGCTGACCCCAGCACCTCCAGG - Intronic
1104723476 12:131060219-131060241 CGGATGCCCCGAGCATCCCCAGG - Intronic
1106421473 13:29589510-29589532 CAGCTGCCCCAAGGACCCCAGGG + Intronic
1106798303 13:33230403-33230425 AGGCTGCCTCCAGGAAACCCAGG - Intronic
1113961151 13:114126931-114126953 CGTCTCCCCCGAGGGCCCCCAGG + Intronic
1114527455 14:23375706-23375728 AGGCTCCCACATGGACCCCCGGG + Exonic
1117072521 14:52069339-52069361 GGGCTGCCCCGCGGCCCCCAAGG + Intergenic
1117627210 14:57652019-57652041 AGGGTACCTGGAGGACCCCCAGG + Intronic
1118767592 14:68920601-68920623 AGGCTGCCCCGAGACTCCCCGGG - Intronic
1119804796 14:77475639-77475661 AGCCTGCACCGACAACCCCCTGG - Exonic
1121731796 14:96192574-96192596 AGGCTGCCCAGAGCTGCCCCCGG - Intergenic
1121845813 14:97171238-97171260 AGGCTCACCCGAGGTCCCACAGG + Intergenic
1122308624 14:100780882-100780904 GGGCTGCTCAGAGGACCTCCAGG + Intergenic
1122608374 14:102963601-102963623 AGGCTGCCACGGGGAACACCTGG + Intronic
1124250214 15:28102082-28102104 AGGTGGCCCCGGGGACCCCTGGG - Intergenic
1127588344 15:60398221-60398243 AGGCTGCCCCGAGGCCCACAGGG + Intronic
1128070332 15:64791864-64791886 AGGCTTCCCAGACTACCCCCTGG + Intergenic
1128095509 15:64950975-64950997 ACGCAGCCCCGAGTGCCCCCAGG + Intronic
1131829617 15:96345736-96345758 AGCCTGCCCGGAGGTCCCCGAGG - Intergenic
1132022528 15:98375204-98375226 AGGATGGCCTAAGGACCCCCAGG - Intergenic
1132400465 15:101501952-101501974 AGACAGGCCCGAGGACTCCCTGG + Intronic
1132525321 16:411357-411379 AGGCTGGCCTGAGGGCCACCTGG - Exonic
1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG + Exonic
1133021261 16:2967918-2967940 CTGCTCCCCCGGGGACCCCCAGG + Exonic
1133311249 16:4847944-4847966 AGGCTGCTCCCCCGACCCCCTGG + Intronic
1134062198 16:11206010-11206032 AGGCTGTCCCCAGGCCCACCTGG - Intergenic
1134114668 16:11539043-11539065 AGGCAGCCCCCAGGGCCCACCGG + Intergenic
1135088601 16:19494377-19494399 AGGCTGCCTTGGGGACCCCTGGG + Intronic
1135480006 16:22814418-22814440 CCGCTGCCCCCGGGACCCCCTGG + Exonic
1135993881 16:27233984-27234006 AGGCAGCCATGGGGACCCCCTGG + Intronic
1136040212 16:27572675-27572697 TGGCTGCCCAGAGGCCCCACTGG + Intronic
1139558722 16:67728605-67728627 TGGGTGAACCGAGGACCCCCAGG + Intronic
1139593845 16:67947220-67947242 AGGGTGCCCCGGGCAGCCCCAGG + Intronic
1140811200 16:78579855-78579877 AGGCTGCCTCGAAGACTCACTGG + Intronic
1141764488 16:86049471-86049493 ATGCTGCCCCAGGGACCCCATGG + Intergenic
1142119025 16:88376905-88376927 AGCGTGCCCCGAGGCCCCCGAGG + Intergenic
1142209977 16:88804204-88804226 AGGGCGCCCCCAGGATCCCCCGG - Intronic
1142876337 17:2853777-2853799 CGGCTGCCCCGCGGGCCCCGAGG + Intronic
1143141624 17:4744610-4744632 AGGCTGTCCTGAGGGGCCCCAGG - Exonic
1143200775 17:5111763-5111785 CGGCTTCCCCGAGGTCCACCTGG - Intronic
1143248576 17:5505393-5505415 TGTCTGCCCCGTGGAGCCCCAGG - Intronic
1143401947 17:6651873-6651895 AGGGTGCCCCGAGGCCTCCCTGG + Exonic
1143621742 17:8084755-8084777 AGGCTGAGCTGAGGACACCCAGG - Intronic
1146683705 17:34826464-34826486 ATGCTGCCCTGCTGACCCCCAGG + Intergenic
1147602375 17:41754509-41754531 AGGCAGCCCTGAGGACCCGCAGG + Intergenic
1147971354 17:44220243-44220265 AGGGTGCCCGGAGGTGCCCCCGG + Intronic
1147971843 17:44222318-44222340 AGGCTGCCCCGCTGCCACCCGGG - Intergenic
1148155025 17:45418748-45418770 AGCCTGCCCCAAGGTTCCCCTGG - Intronic
1148742599 17:49901431-49901453 GGGCTTCTCCGAGAACCCCCAGG + Intergenic
1151571949 17:74930905-74930927 AGCCTTCACCGAGGACCGCCCGG + Exonic
1151615188 17:75205466-75205488 AGGCGGCGCCGGGGACACCCTGG - Intergenic
1151723666 17:75872807-75872829 AGGCTGCCCCGCTGTCCCCTTGG - Intergenic
1151726728 17:75889473-75889495 AAGCTGCCACGAAGACCCCTGGG - Exonic
1151919201 17:77141033-77141055 AGACTGCCCCGCGGAGCCGCCGG + Intronic
1152385332 17:79970722-79970744 AGGCTTCACTGAGGACCCCCAGG - Intronic
1152571876 17:81124520-81124542 AGGGTGCCCCAGGGACCCCATGG - Intronic
1152592127 17:81218847-81218869 AGGCTTCCCACAGGAACCCCTGG - Intronic
1152924141 17:83079838-83079860 CGGCTGCCCCGCGCGCCCCCAGG - Exonic
1154173627 18:12067843-12067865 AGGGTGGGCCGGGGACCCCCTGG + Intergenic
1157552969 18:48594159-48594181 AGGCATCCCCCAGGACCCGCCGG - Intronic
1160243571 18:77139883-77139905 AAGCTGCCCTGAGGCTCCCCAGG + Intergenic
1160730630 19:640235-640257 AGGCTGCACAGAGGAGCCTCCGG - Intronic
1160913929 19:1487852-1487874 CACCTGCCCCCAGGACCCCCTGG - Exonic
1161171133 19:2813011-2813033 GGGTTGCTCCGAGGCCCCCCTGG + Intronic
1161325583 19:3662127-3662149 AGGCAGCCCCGGGGACCACCAGG - Intronic
1161518142 19:4708316-4708338 ACCCTGCACCGAAGACCCCCTGG + Intronic
1162057112 19:8071434-8071456 AGGCTCCCCTTAGGAGCCCCAGG - Intronic
1162457685 19:10795884-10795906 AGGGTGACCCGAGGACCCCACGG - Intronic
1162478647 19:10915541-10915563 ATGGTGCCCCCAGGTCCCCCAGG + Intronic
1162581806 19:11536024-11536046 GGGCAGCCCCGGGTACCCCCAGG - Intergenic
1162943845 19:14030850-14030872 CGGCTGCCCCGAAGAACCCCAGG - Exonic
1163155284 19:15436892-15436914 AAGCTGCCAGGCGGACCCCCAGG + Exonic
1163270103 19:16247921-16247943 AGGCTGCAGGGAGGACCCTCAGG - Intergenic
1163292291 19:16386762-16386784 AGGCTGCCTCGAGTCCCCCCAGG - Intronic
1163478174 19:17539280-17539302 AGGCCGCACCCGGGACCCCCAGG + Intronic
1163678843 19:18669240-18669262 AGGTAGCCCCCAAGACCCCCGGG + Exonic
1163928072 19:20364096-20364118 AGGCTGCCCTGAGGTCTCCTGGG - Intergenic
1165149051 19:33750384-33750406 GGGCTACCCCCAGGACCCCAGGG + Intronic
1165328397 19:35127039-35127061 AGGCAGGCCCCAGGACCCCCAGG + Intronic
1166226216 19:41397246-41397268 AGGCTGCAGCCAGGACCCCGAGG + Exonic
1167076484 19:47252903-47252925 AGGCTGCCCAGAGCACCCTGGGG - Intergenic
1167247490 19:48382649-48382671 GGGCTGGCCCGAGGATCCCATGG - Exonic
1168075709 19:53980134-53980156 ACCTTGCCCCGAGCACCCCCGGG + Intronic
1202712362 1_KI270714v1_random:25401-25423 TGGCTGCGCCGCGGACCCCAAGG - Intergenic
925018363 2:548835-548857 AGGCTCCCTGCAGGACCCCCAGG + Intergenic
925391971 2:3501373-3501395 AGACTGCCCCAAAGACACCCTGG + Intronic
925829798 2:7882856-7882878 AGGCTGCCACCAGGACCCCCGGG + Intergenic
926196842 2:10769120-10769142 AGGCTGCACGGAGGGCCCCCAGG + Intronic
926757823 2:16250234-16250256 AGGGGGTCCTGAGGACCCCCAGG + Intergenic
927518068 2:23683378-23683400 TGCCTGCCCCCAGGATCCCCTGG - Intronic
929820370 2:45268755-45268777 TGGCTGCCCCGAGGACTAGCTGG - Intergenic
930177492 2:48315165-48315187 AGGGGGCCCCAAGGACCCTCAGG + Intronic
932257723 2:70301782-70301804 AGGCCGCCCCGGCGACCCCAGGG + Intronic
933093017 2:78145632-78145654 AGTCTGCCCCTGGGAGCCCCCGG + Intergenic
933737142 2:85504294-85504316 CAGCTGCCCCGAGGTCCCTCTGG + Intergenic
934545082 2:95207674-95207696 AGGGTGGCGGGAGGACCCCCGGG + Exonic
938073553 2:128320359-128320381 AAGCTGCCCCCAGGACCCTCGGG - Intergenic
938139972 2:128787339-128787361 AGGATGCCCTGAGGACAGCCAGG - Intergenic
938392148 2:130914981-130915003 AGAGTGCCCCGAGGATCCCGTGG + Intronic
940000360 2:148961327-148961349 AGGCTGGCCAGAGGACACCATGG - Intronic
942414558 2:175745372-175745394 AGCCAGCCCTGAGGACCCACTGG + Intergenic
943624294 2:190181041-190181063 AGGCTGCCTCCGGGACCCCACGG + Exonic
944101941 2:196036614-196036636 AGGCTGGTCCCTGGACCCCCAGG - Intronic
947542926 2:230991025-230991047 CGGCCGCCCCGAGGGCACCCTGG + Intergenic
947843891 2:233228308-233228330 AGGCTCACCCGAGAACCCTCTGG - Intronic
948601362 2:239109130-239109152 GGGCTGCCCCGAGGCCCTGCCGG + Intronic
948641790 2:239379687-239379709 TGGCAGCCCCAAGGAGCCCCAGG + Intronic
948785086 2:240348082-240348104 GGGCCTCCCCGAGGTCCCCCTGG - Intergenic
948901194 2:240957702-240957724 GGGCTGCCCAGAGGAGCTCCTGG + Intronic
949035496 2:241814151-241814173 AGGCTGGCCAGAGAGCCCCCGGG - Intronic
1170759866 20:19239830-19239852 AGGCTGCCCACAGGGCCCCTGGG - Intronic
1172028968 20:31968292-31968314 CGCCCGCCCCGACGACCCCCGGG - Exonic
1172101081 20:32484143-32484165 AGGCTGCCCGAAGGGGCCCCGGG - Intronic
1172437826 20:34942468-34942490 GGGCTGCCCAGGGGACCCACCGG + Exonic
1175172359 20:57089752-57089774 AGGCTGCCCCAAGCAGCCACAGG + Intergenic
1175539713 20:59740918-59740940 TGGCTGCCCCAAGGAGGCCCAGG - Intronic
1175889448 20:62309861-62309883 AGGCTGGGCTGAGGACCACCTGG - Intronic
1175937093 20:62518859-62518881 CGCCTGCCCCGAGGTCCCCAAGG - Intergenic
1176025936 20:62985684-62985706 AGGCTGCCGCAAGGACTCCGGGG + Intergenic
1176706694 21:10123501-10123523 AGGCTGCTACGAGTACCCCAAGG + Intergenic
1179566146 21:42250407-42250429 AGGATGCCCAGAGCACCCACGGG - Intronic
1179838216 21:44051814-44051836 AGACTGCCCACAGGAACCCCAGG - Intronic
1179882878 21:44300662-44300684 AGGCGGCCGCGAGGGCCCCGAGG - Intronic
1179991843 21:44952451-44952473 AGGCGGCCCCGGGAATCCCCAGG - Intronic
1180252207 21:46597146-46597168 AGGCTGCCTCCAGCATCCCCAGG - Intergenic
1181594590 22:23906198-23906220 ATGCTGCCCCGAGGTCTCCAAGG + Intergenic
1181768855 22:25111519-25111541 AGGCAGCCACCAGGGCCCCCGGG - Intronic
1182445644 22:30387748-30387770 CGGCAGCCCCGTGGACCCACGGG + Intronic
1183282251 22:36938047-36938069 GGGCTGGCCAGTGGACCCCCTGG + Exonic
1183719945 22:39557017-39557039 AGGCTTCTCAGAGGGCCCCCAGG - Intergenic
1183780472 22:39995619-39995641 AGGCCGCCCTGAGCACCCTCTGG + Intronic
1183951128 22:41353707-41353729 AGCCTGGCCCAGGGACCCCCCGG - Intronic
1184689180 22:46109769-46109791 AGCCTGCCTCGAGCACTCCCTGG + Intronic
1185007315 22:48288738-48288760 AGGAGGCCCTGAGGACGCCCGGG - Intergenic
1185324562 22:50219385-50219407 CGCCTTCCCCGTGGACCCCCAGG - Exonic
949387639 3:3521154-3521176 AGGCTTCCCAGAAGACACCCAGG - Intergenic
950870106 3:16220828-16220850 AGCCTGCCCCCAGGAACCCAGGG - Intronic
954105109 3:48405674-48405696 AGGCTGACCCAAGGCCTCCCAGG - Intronic
954579963 3:51697869-51697891 AGGAAGCCCCGAGGGCACCCAGG + Intronic
954677825 3:52325385-52325407 AGGCTGCCCAGAGCCCACCCAGG + Intronic
961213187 3:125141353-125141375 AGGCTCCCACGAGCACCCCTTGG - Intronic
961403406 3:126662915-126662937 AGGCAGCCCCCAGGACCCTGGGG + Intergenic
961456651 3:127027898-127027920 AGGCTGCAGCCAGGACCCCCGGG - Intronic
961551333 3:127672162-127672184 AGGGTGCCGCGGGAACCCCCTGG + Intronic
963787353 3:149548365-149548387 AGGCTGCCCAGAGCACCTCCTGG + Intronic
963805105 3:149714582-149714604 AGGCTGTCCTCAGCACCCCCTGG - Intronic
966883665 3:184362950-184362972 AGCCGGCACCGAGGACCCCGGGG - Intronic
967911517 3:194546143-194546165 AGGCTGTCCCGGAGACCACCAGG + Intergenic
968082115 3:195853845-195853867 AGGCAGCCCCGAGGCCTCCTCGG + Intergenic
968505469 4:969178-969200 AGGCTGTCCCCAGGACCCGGGGG - Intronic
968818608 4:2834205-2834227 GGGCTGGCCCTGGGACCCCCAGG + Exonic
969100244 4:4763181-4763203 AGGCTGCACAGAGGAATCCCAGG + Intergenic
970163114 4:13209233-13209255 AGGCTGCACTGAGGACTCCATGG - Intergenic
970850033 4:20590493-20590515 AGGCTGCCCCAGGGAGTCCCAGG + Intronic
973858007 4:55032868-55032890 AGGCTGCCCTCTGGACCCCAGGG + Intergenic
975701871 4:77075299-77075321 GGGCGGCCCCGAGGTTCCCCGGG + Intronic
975855640 4:78621701-78621723 ATGCTGCCCCTGAGACCCCCAGG + Intergenic
976608727 4:87007234-87007256 GGGCTGCGCCGAGGACGCCCGGG + Intronic
981724126 4:147830019-147830041 AGTCTGCCCCCAGCACCCCCAGG - Intronic
984024000 4:174521851-174521873 AGGCGGCACCCAGGGCCCCCTGG + Intronic
984717549 4:182939807-182939829 AGACTGGAACGAGGACCCCCTGG - Intergenic
985381438 4:189399072-189399094 AGGCTGCCCCCAGGGCCTCAGGG - Intergenic
985771679 5:1815627-1815649 AGCCATCCCCTAGGACCCCCAGG - Intronic
985783369 5:1882147-1882169 GGCGTGCCCCGAGTACCCCCGGG + Intronic
986710710 5:10486249-10486271 AGGCTTCCTCCAGGCCCCCCGGG + Intergenic
992019471 5:72607644-72607666 TGGCTGCCCCAAGGGCCCCCTGG - Intergenic
995047706 5:107670260-107670282 AGGCAGCCCCGGGGACTCCCAGG + Intronic
997580046 5:135011459-135011481 AGGCAGGCTCCAGGACCCCCTGG - Intronic
998151669 5:139760910-139760932 AGCCTGCCCCGGGGATCTCCTGG + Intergenic
998172398 5:139880389-139880411 AGGCTGCCACCAGGGGCCCCAGG + Intronic
1000344629 5:160304475-160304497 AGTCTGCCCTCATGACCCCCTGG - Intronic
1001437071 5:171707722-171707744 AGGCTGCTCTGAGGATCCACTGG + Intergenic
1001758113 5:174186283-174186305 AGGCTGCCCCGAGGACCCCCCGG + Intronic
1002103634 5:176869386-176869408 TGGCTACCCCGAGTGCCCCCTGG + Intronic
1002323819 5:178392319-178392341 AGTGTGCTCCGAGGACACCCAGG - Intronic
1002347792 5:178560057-178560079 AAGCTCCCCTGAGGACACCCAGG + Intronic
1002518628 5:179777536-179777558 AGGCTGGCCCCAGGACTCACGGG + Intronic
1003421311 6:5960759-5960781 AAGCTGCCCCAAGCTCCCCCAGG - Intergenic
1003521693 6:6863519-6863541 TGGCTGCCACGAGGACACCTTGG - Intergenic
1006629658 6:35422018-35422040 AGGCTGCCCCAAGGGCTCCCTGG - Intronic
1006750831 6:36375800-36375822 AGGATGGCCCAAGTACCCCCGGG - Intronic
1007414569 6:41684182-41684204 AGGCAGGCCTGAGCACCCCCAGG + Exonic
1009473313 6:64055977-64055999 ATGCTGCCCAGAGGCCCCTCGGG + Intronic
1010152983 6:72758068-72758090 AGAATGCCCAGAGGTCCCCCAGG + Intronic
1013631356 6:111989203-111989225 TGGCTGCCCAGAGTACACCCAGG + Intergenic
1014122368 6:117740078-117740100 CAGCTCCACCGAGGACCCCCTGG + Intergenic
1015917991 6:138237683-138237705 AGGCTGCTGTGAGGAACCCCAGG - Intronic
1015939076 6:138431183-138431205 AGGCGGCCTCAAGGATCCCCGGG + Exonic
1018055379 6:160047836-160047858 TGCCTGCCCGGAGGAGCCCCTGG + Exonic
1018924352 6:168195903-168195925 CGGTTACCCCGAGGTCCCCCAGG + Intergenic
1019279664 7:193391-193413 GGGCCGCCCCGGGGAGCCCCCGG + Exonic
1019506873 7:1395807-1395829 AGCCTGCCCCCGGGCCCCCCTGG - Intergenic
1019609297 7:1928870-1928892 TGGCTGCTCCGTGGACCACCAGG - Intronic
1020094864 7:5362606-5362628 AGCCTCCCCCGCGGACCCCAGGG + Intronic
1023864414 7:44232092-44232114 TGGGTGCCCCTTGGACCCCCTGG + Intronic
1025176498 7:56804829-56804851 AGCCTGGCCCGAGGACGCCATGG - Intergenic
1025181143 7:56824500-56824522 AGCCTGGCCCGAGGACGCCACGG + Intronic
1025695293 7:63771557-63771579 AGCCTGGCCCGAGGACGCCATGG + Intergenic
1028754522 7:94420263-94420285 GGGCTTCCCCGAGGACCAGCAGG - Exonic
1033261111 7:139844883-139844905 TGGCTGGCCCAAGGACACCCAGG - Intronic
1033283786 7:140023891-140023913 TAGCTTCCCCGAGGACCCCCAGG - Exonic
1034537721 7:151736168-151736190 AGGTCGCCCTGAAGACCCCCTGG - Intronic
1035223534 7:157420816-157420838 TGGCTCCTCCGAGGACCCCGAGG + Intergenic
1037763240 8:21756125-21756147 CGGCTGCCCCCAGGTTCCCCAGG + Intronic
1037909995 8:22738569-22738591 AGGTTGCCCCTAGGCCCCCTTGG - Intronic
1040485165 8:47864240-47864262 TGGCAGCCCCTAGGACCGCCAGG + Intronic
1041649929 8:60292300-60292322 AGACTGCCCAGAAGAACCCCAGG - Intergenic
1043053245 8:75407428-75407450 TGGCTGCCCCGCGGAGGCCCGGG + Intergenic
1048441365 8:134461966-134461988 TGGCTGCCCTGGGGACCCCTCGG + Intergenic
1049689665 8:143953069-143953091 AGGCGTCCCCCAAGACCCCCGGG + Intronic
1049742915 8:144249608-144249630 ACGCTGGCCCTGGGACCCCCAGG - Intronic
1049988547 9:972745-972767 CGGCTGCCCCCAGGGCCTCCAGG + Intergenic
1051606121 9:18919042-18919064 AGCCTGCCCAGATGGCCCCCAGG - Intergenic
1053201042 9:36151737-36151759 CGGCTGCCCAGAGGGACCCCGGG - Intronic
1053643990 9:40110621-40110643 AGGCTGCTACGAGTACCCCAAGG + Intergenic
1053762163 9:41354868-41354890 AGGCTGCTACGAGTACCCCAAGG - Intergenic
1054324845 9:63707850-63707872 AGGCTGCTACGAGTACCCCAAGG + Intergenic
1054540759 9:66265988-66266010 AGGCTGCTACGAGTACCCCAAGG - Intergenic
1057147073 9:92765297-92765319 CGGCTGCCGGGAGAACCCCCAGG + Intergenic
1057600326 9:96451092-96451114 AGGCCGCCCCGCGGTCGCCCAGG - Intronic
1060881694 9:127122361-127122383 AGGCTGCCCCGCTGACGGCCAGG - Exonic
1061055667 9:128221547-128221569 GGGCTGCCCCTTGGACCCTCTGG - Intronic
1061108883 9:128552811-128552833 AGGCAGCCCCGCGGCCCGCCCGG - Intronic
1061215342 9:129218492-129218514 GGGCTGCTCGGAGGACCCACAGG - Intergenic
1061669840 9:132182532-132182554 CTGCTGCCTCCAGGACCCCCTGG - Intronic
1061802073 9:133118132-133118154 GGGCAGCCCCCAGGACCCTCAGG - Intronic
1062010239 9:134263235-134263257 AGGGCGCCCTGAGCACCCCCTGG - Intergenic
1062041701 9:134407396-134407418 AGTCAGCGCCGAGGACCCACAGG - Intronic
1062116185 9:134810347-134810369 AGCCTGCGACGAGGCCCCCCGGG - Intronic
1062315639 9:135965751-135965773 AGGCTGTCCTGAGGCCTCCCAGG + Intergenic
1062410700 9:136422700-136422722 GGGCTGCACCCAGGAACCCCAGG - Intronic
1062501163 9:136852631-136852653 TGGCAGGCCCGAGGACCCCATGG - Intronic
1062731320 9:138111745-138111767 ACCCTGCCCCGAGGCCTCCCTGG + Intronic
1203769150 EBV:40278-40300 CGGCTGCCCCCTGGACCCCTAGG - Intergenic
1185457891 X:319682-319704 AGGCGGCGTCCAGGACCCCCAGG - Intergenic
1185578300 X:1191076-1191098 AAGTGGCCCCGAGGAGCCCCTGG - Exonic
1187190772 X:17032726-17032748 AGGCTTCCCCCAGGACCCAGAGG - Intronic
1190165769 X:48071721-48071743 AGGCTGGACAGAGCACCCCCCGG + Intergenic
1190221300 X:48514113-48514135 ATGGTGCCCCTAGGGCCCCCAGG - Exonic
1200065831 X:153503717-153503739 AGGCTTGCCTGAGGCCCCCCAGG - Intronic
1200074961 X:153546306-153546328 AGGATGCCCTGAGCAGCCCCAGG - Intronic
1200101019 X:153689069-153689091 AGGCTGCCCCCCAGACTCCCGGG + Intronic