ID: 1001760566

View in Genome Browser
Species Human (GRCh38)
Location 5:174204674-174204696
Sequence TCATAGAGACTATGCTGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001760562_1001760566 25 Left 1001760562 5:174204626-174204648 CCTAATATCACAGATGGGAAAGA 0: 1
1: 0
2: 5
3: 52
4: 432
Right 1001760566 5:174204674-174204696 TCATAGAGACTATGCTGTGACGG 0: 1
1: 0
2: 0
3: 17
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001760566 Original CRISPR TCATAGAGACTATGCTGTGA CGG Intronic
906863609 1:49390780-49390802 TCATAGACAATAAGCTGTCAAGG - Intronic
907759810 1:57346341-57346363 TCAAAGAGATTTTGATGTGAAGG + Intronic
910489145 1:87748897-87748919 TCATTCAGAATATGATGTGAAGG + Intergenic
914262969 1:146014951-146014973 GCATAGAGACAGTGCTTTGAGGG - Intergenic
916204243 1:162300052-162300074 TCAGAGAGACTTTGCTGTCCAGG - Intronic
916965521 1:169938156-169938178 TGATAGAGACTGTGCTTAGATGG + Intronic
919876875 1:201875716-201875738 TTCTAGAGGCTATGTTGTGAAGG + Intronic
921005630 1:211090869-211090891 TCACAGTGACTATTCAGTGAGGG + Intronic
922915346 1:229252828-229252850 TCATGGAGACTAGGCTGTAAGGG - Intergenic
1062901642 10:1151096-1151118 TCATAGAGAACATTTTGTGAAGG - Intergenic
1065505990 10:26430703-26430725 TCATGGAGACGATGGTGTGGGGG - Intergenic
1066999485 10:42594123-42594145 TCATAGTGACTGTCCTTTGATGG + Exonic
1071002084 10:80841962-80841984 TCTGAGGGACTGTGCTGTGAGGG - Intergenic
1071167708 10:82826161-82826183 TCATAGAGAGTTTGATATGAAGG + Intronic
1072434005 10:95398915-95398937 TTACAGAGACGATGGTGTGATGG + Intronic
1074047537 10:109852303-109852325 TCACAGAGCCTGTGCTTTGACGG - Intergenic
1076298908 10:129409693-129409715 CCATAGATAGTATGCTGGGAAGG - Intergenic
1079242970 11:18733612-18733634 TCAGACACACTCTGCTGTGAGGG + Exonic
1082699289 11:56408213-56408235 TCATGGAGACTAAGCTGTATAGG + Intergenic
1083350138 11:62022190-62022212 TCACAGAGACTAGCTTGTGAAGG + Intergenic
1084468179 11:69339465-69339487 TCAGAGAGGCTCTGCTGTGGGGG - Intronic
1086389179 11:86343692-86343714 TCCAAGAGACTCTGCTGCGAAGG - Intronic
1087718698 11:101637711-101637733 TCAGATAGACTTTGCTGTGTAGG - Intronic
1092653035 12:10654947-10654969 TCAGAGAGACTAGGTAGTGAAGG - Intronic
1094405443 12:30111053-30111075 CCATAGAGAGGATGGTGTGATGG - Intergenic
1095139587 12:38645354-38645376 TCATGGAGACAATTCTGAGAAGG + Intergenic
1097775962 12:63646159-63646181 TCATAGAGCTTATGCTGTAAGGG - Intronic
1099901580 12:88717017-88717039 CCATAAAGACTATGATGTGAAGG - Intergenic
1099937187 12:89140724-89140746 TCGCAGAGATGATGCTGTGAAGG - Intergenic
1101369122 12:104108717-104108739 TCATAGAGATGAGGTTGTGAAGG + Intergenic
1103195176 12:119037477-119037499 TCATCCAGACTATAATGTGATGG - Intronic
1104325197 12:127789308-127789330 TCTTAGAGACTATGGTATGATGG + Intergenic
1107016406 13:35711184-35711206 TCATACAGATGCTGCTGTGAAGG - Intergenic
1108633688 13:52311743-52311765 TCATAGAAAGTATGATGTGTAGG - Intergenic
1111451099 13:88417760-88417782 TCAAATAAACTATGCAGTGAAGG + Intergenic
1113548324 13:111172238-111172260 CCAAAGAGACTATGCTCTAAAGG - Intronic
1115304294 14:31917964-31917986 TCCTAGACACTATGCTGACATGG - Intergenic
1119432153 14:74575489-74575511 TCACAGAGACTATAATGTGAAGG + Intronic
1119432363 14:74576654-74576676 TCACAGAGAGTATGATATGATGG + Intronic
1123577583 15:21688406-21688428 TCATAAAAACTATGCTTAGAAGG - Intergenic
1130217724 15:81987958-81987980 TCAGATAGAGAATGCTGTGAAGG + Intergenic
1130863558 15:87912306-87912328 TCATGGAGACTGTGCTGTATTGG + Intronic
1131138099 15:89953975-89953997 ACATAGAGACTATTCTTAGAGGG + Intergenic
1131645822 15:94342370-94342392 TCAAAGAGACTATGTTTTCAGGG + Intronic
1202986452 15_KI270727v1_random:422651-422673 TCATAAAAACTATGCTTAGAAGG - Intergenic
1136344092 16:29664084-29664106 TCCTAGAGAGTTTGCTGTTATGG - Exonic
1138737308 16:59265440-59265462 TCATAGAGATGCAGCTGTGAAGG + Intergenic
1138927045 16:61604927-61604949 GCAGTGAGACTATGCTGTAATGG + Intergenic
1145670151 17:26434232-26434254 TCACAGAGAATTTTCTGTGAAGG - Intergenic
1148530175 17:48382569-48382591 TCATAAAGACTATACTTTCAGGG - Intronic
1149220126 17:54407628-54407650 TCATGGAGACTATGTTGTACTGG - Intergenic
1150291004 17:63982171-63982193 TCAGAGACACTTAGCTGTGAGGG - Intergenic
1153622649 18:6994031-6994053 TCCTAGTGGCTATACTGTGAGGG + Intronic
1154232339 18:12568522-12568544 TCATAGAGATTGTGATGCGATGG - Intronic
1156397172 18:36708923-36708945 TCATCGAGGCAATGCTGTGAAGG - Intronic
1158097579 18:53791572-53791594 TCATAATGACAAGGCTGTGAGGG - Intergenic
1163134108 19:15296896-15296918 TCATGGAGAGTAGGCTCTGACGG + Intronic
1166702286 19:44889019-44889041 TCATACAGACTGTGCCTTGATGG + Exonic
925867807 2:8244376-8244398 TCAAAGTGATTATGATGTGAGGG - Intergenic
927774301 2:25890214-25890236 TCTTAGAGCCTATTTTGTGAGGG + Intergenic
928636168 2:33249014-33249036 CCATAGATACTAAGCTGTAAAGG + Intronic
929433013 2:41904503-41904525 TTATAGAGACTAGGGTGGGAGGG + Intergenic
929730525 2:44486605-44486627 TCATAAACACTATCCTGTGTAGG - Intronic
935004407 2:99057684-99057706 TGATAGAGACTATGCTGAGCTGG - Intronic
936968804 2:118154136-118154158 TAATATAGACCAGGCTGTGATGG - Intergenic
937080062 2:119134513-119134535 TCCCAGAGTCTATGCTGGGAGGG - Intergenic
938924960 2:136030532-136030554 TTATAGAAACTATGATGTGAAGG - Intergenic
940071388 2:149692177-149692199 TCAGAGAGACTGCTCTGTGAAGG + Intergenic
940164346 2:150752918-150752940 TTATTGAGACTATACTTTGAGGG + Intergenic
940730650 2:157386430-157386452 TCATAGAGATACTGCTTTGATGG - Intergenic
944180800 2:196890634-196890656 TCACAGATACTATGCTATTAAGG - Intronic
946591568 2:221254919-221254941 TAATAGGCACTCTGCTGTGAAGG - Intergenic
1169667616 20:8055532-8055554 TCATGGAGACAATGCTGACATGG - Intergenic
1169834631 20:9864583-9864605 TAATAGTGACTTTGCTGTCATGG - Intergenic
1169942868 20:10956185-10956207 GCATAAAGTCTATGCTGTTAGGG - Intergenic
1178334948 21:31734053-31734075 TTATAGAAACTTGGCTGTGAAGG + Intergenic
1178885740 21:36483541-36483563 TCATAGGAACCATGCGGTGAAGG + Intronic
1179017553 21:37606259-37606281 TTAAAGAAACTATGCTCTGAAGG - Intergenic
951677023 3:25252934-25252956 TCATAGAGACTCTGCTCAGTTGG - Intronic
952068233 3:29598735-29598757 TCTTAGAGACTCTGATCTGATGG - Intronic
957549913 3:81690647-81690669 TCATGGTGACGATGCTGTTATGG - Intronic
959446882 3:106451455-106451477 TGATAGGAACTATGCTGTGGCGG - Intergenic
959892184 3:111569973-111569995 TCATACAGACTGTGCCTTGACGG - Intronic
960101592 3:113747581-113747603 TCACAGTGACTCTGCAGTGAGGG - Intronic
963685573 3:148429877-148429899 TCCTAAGGACTATCCTGTGAAGG + Intergenic
964144723 3:153445418-153445440 GAATAGAGAGTATACTGTGATGG + Intergenic
964410082 3:156388959-156388981 TAAGAGAGACTGGGCTGTGATGG + Intronic
965240696 3:166193133-166193155 TCTTGCAGACTCTGCTGTGATGG + Intergenic
966690074 3:182732675-182732697 TCGTGAAGACTATGCTATGACGG - Intergenic
974301592 4:60075386-60075408 TCCTTGAGACTATGCCATGAAGG + Intergenic
978796034 4:112708528-112708550 TCAATGAAACTATGCTGTGTGGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
982129011 4:152210236-152210258 CCAAAGAGACTCTGCTGTGGTGG + Intergenic
983274191 4:165597836-165597858 TCACAGAGACTAAGCAGTGCAGG + Intergenic
985318489 4:188683214-188683236 TCATCACGACTATGCTGTGAGGG + Intergenic
987135007 5:14892155-14892177 TCAAGGAGATTATGCTCTGAAGG - Intergenic
991365005 5:65859366-65859388 TAATAGAGAGAATGCTCTGATGG + Intronic
992791373 5:80217312-80217334 TCATGGAGATTATGCTGCAAGGG + Intronic
993539839 5:89135167-89135189 TCCCAGAGACTATGCTGTGTTGG - Intergenic
995511415 5:112913850-112913872 TCTTAGAGACTAAGCTGCTAGGG - Intronic
998402932 5:141857392-141857414 TCATAGTAACTGTGCTGGGATGG + Exonic
998812449 5:145979683-145979705 TCTTAGAGACAATGGTGTGCTGG - Intronic
999574247 5:152956658-152956680 AGCTGGAGACTATGCTGTGAAGG - Intergenic
1001739585 5:174041062-174041084 TCATAGTTACTCTACTGTGAGGG - Intergenic
1001760566 5:174204674-174204696 TCATAGAGACTATGCTGTGACGG + Intronic
1006743343 6:36324478-36324500 TCATAGAAAATATGCCTTGAAGG - Intronic
1014017200 6:116546810-116546832 TCATAGAACATATGCAGTGATGG - Intronic
1015415772 6:132946264-132946286 TCATATTGCCTATGCTGTGAAGG - Intergenic
1015573028 6:134641563-134641585 TGATTGAGACTTTCCTGTGAAGG - Intergenic
1020644241 7:10794752-10794774 TCATTGAGACTATTCTGGAATGG + Intergenic
1021089785 7:16469891-16469913 TCATAGTGAGTAGGCTGAGAAGG - Intronic
1021418087 7:20411799-20411821 TCATACAGGCTATGGTGCGAAGG - Exonic
1021623750 7:22572714-22572736 TCAGAGAGAAGATGATGTGAAGG - Intronic
1022615571 7:31926720-31926742 TGCTAGGGACTGTGCTGTGAGGG + Intronic
1022697617 7:32725276-32725298 TCATAGAGTTTATGCTGTAAGGG - Intergenic
1022934861 7:35163754-35163776 TCATAGAGTTTATGCTGTAAGGG - Intergenic
1025527365 7:61832175-61832197 TCTTAGAAACTACTCTGTGATGG - Intergenic
1029830807 7:103256518-103256540 TCATAGAGTTTATGCTGTAAGGG - Intergenic
1030301226 7:107976716-107976738 TCACAGAGTCCATGCTGGGAAGG - Intronic
1032540635 7:132700169-132700191 TCCTAGATTCTGTGCTGTGATGG - Intronic
1034022701 7:147662313-147662335 TCATTTAGACTATGATGGGATGG + Intronic
1034307954 7:150061209-150061231 AGAAAGAGGCTATGCTGTGATGG + Intergenic
1034798899 7:154039460-154039482 AGAAAGAGGCTATGCTGTGATGG - Intronic
1038608546 8:29036191-29036213 ACATAGAGTCTTTGCAGTGAAGG + Intronic
1039209052 8:35190925-35190947 TCATAAAGATTATGCTGAAATGG - Intergenic
1039250815 8:35662091-35662113 TCATAGAGAAAATGCTGGAATGG - Intronic
1039299069 8:36189869-36189891 TCATAGACTATATGCTGTGAAGG - Intergenic
1041946957 8:63455570-63455592 TCATATACTCTCTGCTGTGATGG - Intergenic
1043859092 8:85294847-85294869 GCATAAAGACTATGCTGTGCTGG + Intergenic
1046212320 8:111093021-111093043 TCAGAGATACTATGCTTTCATGG + Intergenic
1046302891 8:112320977-112320999 TCATAGAGACTTTGTCGTGGTGG - Intronic
1056382061 9:86064616-86064638 TCATAGGGTTTAAGCTGTGATGG - Intronic
1059825677 9:118026191-118026213 TCACAGAGACCATGCGGTGTGGG - Intergenic
1060463008 9:123876318-123876340 TCATAGGGAAAATGCTGTAAAGG + Intronic
1061468584 9:130803874-130803896 TCATAAAGACTTTGATGTGTTGG - Intronic
1062378582 9:136276026-136276048 GCATAGAGACTTTGCTTTAAAGG + Intergenic
1189890342 X:45595166-45595188 TCATTGAAACATTGCTGTGATGG + Intergenic
1192793642 X:74408830-74408852 TCAAAAACATTATGCTGTGAAGG + Intergenic
1196334090 X:114510200-114510222 ACATAGAGACTGTGCTTTCAAGG - Intergenic
1196548065 X:116988444-116988466 TCAAAGATACTCTGCTGTGCTGG + Intergenic